Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000006

Orthogroup ID

OG0016404

Physical Location & Seq

Genomic Coordinates Reverse (-)

27970472 .. 27970987

Gene Structure 516 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_6G00405530.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 516 bp

ATGATGGAGAAGATCAAACAGCTAATTGATTACCATGATCATAAGAAGATTCCTCATTCAATAGCTATTGAGGATGGAAAGTCTTATGATCACATCATGAGCCAAATTGGAAGAAACCCCACTGATTCTCTATTTGGTTCTTTGAAGAGAGTAAAGAGAAAAGAATTTTTGATGATGACAGAAAGTTCTAGCAGCAGTAGTGCAATAGCTGCCAATAAAATGGAGCTGCCCCTAGCAAGTACTGATGGCCACCGTGGAGCTGGGGGTATGGAGTGGGCATCTTGTGGAGTAGAATCTGATGGAAATAGAAGTGAGCAGATGGAAATAAATCATTTGGGGTTTAGTTTGGATATGCCTTTTCATGGTGATGATATAAATTGGAATACTGTTGGAGGGAGCAATGCTCGGTATAATGATAATGGAGGGAATTTGCTGCATCTGCTGAGAATGGAGGTGGTATGGAAACTGATATGGGGCTGCCTCCTTGGTTATTTGGAGATAACAATGCCGAAGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

171

Amino Acids

19.14

Weight (kDa)

6.04

Isoelectric Point (pI)

51.89

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016404)

Species	Orthologous Gene IDs
malus_domestica	MD12G1079200.v1.1 MD13G1281000.v1.1 MD14G1041400.v1.1
prunus_persica	Prupe.1G168600_v2.0.a1 Prupe.1G168700_v2.0.a1 Prupe.1G168900_v2.0.a1 Prupe.7G092800_v2.0.a1 Prupe.7G092900_v2.0.a1
rosa_multiflora	Rmu_co8399941.1_g000001
rosa_roxburghii	Rroxscaffold_3G00224350 Rroxscaffold_6G00405530
rosa_samantha	Rh7BG429600 Rh7CG476700 Rh7DG445900
rosa_wichuraiana	Rw7G038040

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcoI	YGGCCR	1 cut(s)	247
AcsI	RAATTY	2 cut(s)	164, 427
AfaI	GTAC	1 cut(s)	241
AfiI	CCNNNNNNNGG	1 cut(s)	362
AgsI	TTSAA	2 cut(s)	60, 145
AluBI	AGCT	5 cut(s)	22, 65, 209, 226, 260
AluI	AGCT	5 cut(s)	22, 65, 209, 226, 260
AoxI	GGCC	1 cut(s)	247
ApeKI	GCWGC	5 cut(s)	192, 209, 226, 433, 477
ApoI	RAATTY	2 cut(s)	164, 427
AsuHPI	GGTGA	1 cut(s)	377
BalI	TGGCCA	1 cut(s)	249
BbvI	GCAGC	5 cut(s)	196, 204, 213, 420, 464
BccI	CCATC	4 cut(s)	68, 239, 293, 313
BclI	TGATCA	2 cut(s)	37, 88
BfaI	CTAG	2 cut(s)	189, 233
BisI	GCNGC	5 cut(s)	193, 210, 227, 434, 478
BlsI	GCNGC	5 cut(s)	194, 211, 228, 435, 479
BmcAI	AGTACT	1 cut(s)	241
BmsI	GCATC	2 cut(s)	287, 445
BplI	GAGNNNNNCTC	2 cut(s)	388, 420
BsaJI	CCNNGG	2 cut(s)	253, 484
Bsc4I	CCNNNNNNNGG	1 cut(s)	362
Bse3DI	GCAATG	1 cut(s)	406
BseDI	CCNNGG	2 cut(s)	253, 484
BseGI	GGATG	1 cut(s)	79
BseLI	CCNNNNNNNGG	1 cut(s)	362
BseMI	GCAATG	1 cut(s)	406
BseMII	CTCAG	1 cut(s)	434
BseXI	GCAGC	5 cut(s)	196, 204, 213, 420, 464
BseYI	CCCAGC	1 cut(s)	260
BshFI	GGCC	1 cut(s)	249
BslI	CCNNNNNNNGG	1 cut(s)	362
BsnI	GGCC	1 cut(s)	249
Bsp143I	GATC	3 cut(s)	12, 37, 88
BspANI	GGCC	1 cut(s)	249
BspCNI	CTCAG	1 cut(s)	435
BspHI	TCATGA	1 cut(s)	96
BsrDI	GCAATG	1 cut(s)	406
BssECI	CCNNGG	2 cut(s)	253, 484
BssMI	GATC	3 cut(s)	12, 37, 88
BssT1I	CCWWGG	1 cut(s)	484
Bst4CI	ACNGT	2 cut(s)	254, 388
Bst6I	CTCTTC	1 cut(s)	140
BstAPI	GCANNNNNTGC	1 cut(s)	209
BstDEI	CTNAG	1 cut(s)	443
BstDSI	CCRYGG	1 cut(s)	253
BstF5I	GGATG	1 cut(s)	79
BstKTI	GATC	3 cut(s)	15, 40, 91
BstMBI	GATC	3 cut(s)	12, 37, 88
BstMWI	GCNNNNNNNGC	2 cut(s)	209, 439
BstV1I	GCAGC	5 cut(s)	196, 204, 213, 420, 464
BstXI	CCANNNNNNTGG	1 cut(s)	220
BsuRI	GGCC	1 cut(s)	249
BtgI	CCRYGG	1 cut(s)	253
BtsCI	GGATG	1 cut(s)	79
BtsIMutI	CAGTG	1 cut(s)	120
CciI	TCATGA	1 cut(s)	96
Csp6I	GTAC	1 cut(s)	240
CviAII	CATG	3 cut(s)	35, 97, 362
CviJI	RGCY	8 cut(s)	22, 65, 102, 209, 226, 249, 260, 477
CviKI_1	RGCY	8 cut(s)	22, 65, 102, 209, 226, 249, 260, 477
CviQI	GTAC	1 cut(s)	240
DdeI	CTNAG	1 cut(s)	443
DpnI	GATC	3 cut(s)	14, 39, 90
DpnII	GATC	3 cut(s)	12, 37, 88
EaeI	YGGCCR	1 cut(s)	247
Eam1104I	CTCTTC	1 cut(s)	140
EarI	CTCTTC	1 cut(s)	140
Eco130I	CCWWGG	1 cut(s)	484
EcoT14I	CCWWGG	1 cut(s)	484
ErhI	CCWWGG	1 cut(s)	484
FaeI	CATG	3 cut(s)	38, 100, 365
FatI	CATG	3 cut(s)	34, 96, 361
FbaI	TGATCA	2 cut(s)	37, 88
Fnu4HI	GCNGC	5 cut(s)	193, 210, 227, 434, 478
FokI	GGATG	1 cut(s)	86
Fsp4HI	GCNGC	5 cut(s)	193, 210, 227, 434, 478
FspBI	CTAG	2 cut(s)	189, 233
GluI	GCNGC	5 cut(s)	193, 210, 227, 434, 478
GsaI	CCCAGC	1 cut(s)	264
HaeIII	GGCC	1 cut(s)	249
Hin1II	CATG	3 cut(s)	38, 100, 365
HinfI	GANTC	3 cut(s)	49, 125, 293
HphI	GGTGA	1 cut(s)	377
Hpy188I	TCNGA	1 cut(s)	298
Hpy188III	TCNNGA	1 cut(s)	97
HpyCH4III	ACNGT	2 cut(s)	254, 388
HpyCH4V	TGCA	2 cut(s)	203, 436
HpyF10VI	GCNNNNNNNGC	2 cut(s)	209, 439
HpyF3I	CTNAG	1 cut(s)	443
Hsp92II	CATG	3 cut(s)	38, 100, 365
Ksp22I	TGATCA	2 cut(s)	37, 88
Kzo9I	GATC	3 cut(s)	12, 37, 88
LmnI	GCTCC	3 cut(s)	223, 257, 396
LpnPI	CCDG	1 cut(s)	246
Lsp1109I	GCAGC	5 cut(s)	196, 204, 213, 420, 464
LweI	GCATC	2 cut(s)	287, 445
MaeI	CTAG	2 cut(s)	189, 233
MalI	GATC	3 cut(s)	14, 39, 90
MboI	GATC	3 cut(s)	12, 37, 88
MboII	GAAGA	4 cut(s)	22, 58, 123, 157
MlsI	TGGCCA	1 cut(s)	249
MluCI	AATT	5 cut(s)	24, 105, 164, 376, 427
MluNI	TGGCCA	1 cut(s)	249
MmeI	TCCRAC	1 cut(s)	370
MnlI	CCTC	6 cut(s)	63, 64, 386, 416, 445, 491
Mox20I	TGGCCA	1 cut(s)	249
MscI	TGGCCA	1 cut(s)	249
MslI	CAYNNNNRTG	1 cut(s)	366
Msp20I	TGGCCA	1 cut(s)	249
MwoI	GCNNNNNNNGC	2 cut(s)	209, 439
NdeII	GATC	3 cut(s)	12, 37, 88
NlaIII	CATG	3 cut(s)	38, 100, 365
PagI	TCATGA	1 cut(s)	96
PfeI	GAWTC	3 cut(s)	49, 125, 293
PkrI	GCNGC	5 cut(s)	194, 211, 228, 435, 479
PspFI	CCCAGC	1 cut(s)	260
RsaI	GTAC	1 cut(s)	241
RsaNI	GTAC	1 cut(s)	240
RseI	CAYNNNNRTG	1 cut(s)	366
SatI	GCNGC	5 cut(s)	193, 210, 227, 434, 478
Sau3AI	GATC	3 cut(s)	12, 37, 88
ScaI	AGTACT	1 cut(s)	241
SetI	ASST	6 cut(s)	24, 67, 211, 228, 262, 456
SfaNI	GCATC	2 cut(s)	287, 445
SmiMI	CAYNNNNRTG	1 cut(s)	366
Sse9I	AATT	5 cut(s)	24, 105, 164, 376, 427
SspMI	CTAG	2 cut(s)	189, 233
StyI	CCWWGG	1 cut(s)	484
TaaI	ACNGT	2 cut(s)	254, 388
TasI	AATT	5 cut(s)	24, 105, 164, 376, 427
TatI	WGTACW	1 cut(s)	239
TfiI	GAWTC	3 cut(s)	49, 125, 293
TscAI	CASTG	1 cut(s)	127
TseI	GCWGC	5 cut(s)	192, 209, 226, 433, 477
TspDTI	ATGAA	1 cut(s)	350
TspRI	CASTG	1 cut(s)	127
XapI	RAATTY	2 cut(s)	164, 427
XcmI	CCANNNNNNNNNTGG	1 cut(s)	257
XspI	CTAG	2 cut(s)	189, 233
ZrmI	AGTACT	1 cut(s)	241

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.