Rroxscaffold_7G00215850

Small ubiquitin-related modifier

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000007
OG0011425
Physical Location & Seq
Forward (+)
66398139 .. 66398501
363 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_7G00215850.1

Sequence Viewer

Length: 363 bp
ATGGAGAGATTTGGTAAATCCAAAATCTCATTTGAGAGATTTAATAAAATTACATCAATAGAGAGTGAAAGGAGATTAGCAACCACCCTGGAATCCCTTGTCAAACTCACTCTTAAGGAAGATGAAGAACCGATAACTCTCCAGGTGCAGAATCAGAATCATGGTGACATCTACTACAGGACCGGTTGCACCGTATCACTTGGACATATATTGAAAGATTACTGTGAACGTAAAGGTTTGGTCTATGAAGAAATGCGTTTCATCTACGATGGAAAAAGGGTACGCTCAACTCACACCCCACAACAACTGGAAATGGAGGATGATTTTGTTATTGATGCAATGTCCGAGCAGATTGGTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 ko05418 map03013 map05418
Pfam Domains
Protein Families
Rad60-SLD

Protein Analysis

120

Amino Acids

14.01

Weight (kDa)

5.42

Isoelectric Point (pI)

53.3

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD PF11976 45 - 114 1.5e-10 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 282
AflII CTTAAG 1 cut(s) 113
AgeI ACCGGT 1 cut(s) 182
AgsI TTSAA 1 cut(s) 214
AjnI CCWGG 2 cut(s) 87, 141
AsiGI ACCGGT 1 cut(s) 182
AspS9I GGNCC 1 cut(s) 180
AsuHPI GGTGA 1 cut(s) 176
AvaII GGWCC 1 cut(s) 180
BccI CCATC 1 cut(s) 263
BciT130I CCWGG 2 cut(s) 89, 143
BfmI CTRYAG 1 cut(s) 175
BfrI CTTAAG 1 cut(s) 113
Bme1390I CCNGG 2 cut(s) 89, 143
Bme18I GGWCC 1 cut(s) 180
BmgT120I GGNCC 1 cut(s) 180
BmrFI CCNGG 2 cut(s) 89, 143
BmsI GCATC 1 cut(s) 325
BpmI CTGGAG 1 cut(s) 125
BsaJI CCNNGG 1 cut(s) 87
BsaWI WCCGGW 1 cut(s) 182
Bse118I RCCGGY 1 cut(s) 182
Bse1I ACTGG 1 cut(s) 312
Bse3DI GCAATG 1 cut(s) 345
BseBI CCWGG 2 cut(s) 89, 143
BseDI CCNNGG 1 cut(s) 87
BseGI GGATG 1 cut(s) 325
BseMI GCAATG 1 cut(s) 345
BseNI ACTGG 1 cut(s) 312
BsgI GTGCAG 1 cut(s) 167
BshTI ACCGGT 1 cut(s) 182
BsiSI CCGG 1 cut(s) 183
BspTI CTTAAG 1 cut(s) 113
BsrDI GCAATG 1 cut(s) 345
BsrFI RCCGGY 1 cut(s) 182
BsrI ACTGG 1 cut(s) 312
BssAI RCCGGY 1 cut(s) 182
BssECI CCNNGG 1 cut(s) 87
Bst2UI CCWGG 2 cut(s) 89, 143
Bst4CI ACNGT 2 cut(s) 193, 224
BstAFI CTTAAG 1 cut(s) 113
BstF5I GGATG 1 cut(s) 325
BstNI CCWGG 2 cut(s) 89, 143
BstSCI CCNGG 2 cut(s) 87, 141
BstSFI CTRYAG 1 cut(s) 175
BtsCI GGATG 1 cut(s) 325
Cfr10I RCCGGY 1 cut(s) 182
Cfr13I GGNCC 1 cut(s) 180
Csp6I GTAC 1 cut(s) 281
CspAI ACCGGT 1 cut(s) 182
CviAII CATG 1 cut(s) 161
CviQI GTAC 1 cut(s) 281
Eco47I GGWCC 1 cut(s) 180
EcoRII CCWGG 2 cut(s) 87, 141
FaeI CATG 1 cut(s) 164
FaiI YATR 4 cut(s) 162, 207, 209, 246
FatI CATG 1 cut(s) 160
FokI GGATG 1 cut(s) 332
GsuI CTGGAG 1 cut(s) 125
HapII CCGG 1 cut(s) 183
Hin1II CATG 1 cut(s) 164
HinfI GANTC 3 cut(s) 92, 151, 157
HpaII CCGG 1 cut(s) 183
HphI GGTGA 1 cut(s) 176
Hpy166II GTNNAC 1 cut(s) 227
Hpy188I TCNGA 2 cut(s) 156, 346
Hpy8I GTNNAC 1 cut(s) 227
HpyCH4III ACNGT 2 cut(s) 193, 224
HpyCH4IV ACGT 1 cut(s) 229
HpyCH4V TGCA 3 cut(s) 148, 189, 338
HpySE526I ACGT 1 cut(s) 229
Hsp92II CATG 1 cut(s) 164
LpnPI CCDG 7 cut(s) 74, 101, 128, 155, 163, 196, 293
LweI GCATC 1 cut(s) 325
MaeII ACGT 1 cut(s) 229
MaeIII GTNAC 1 cut(s) 164
MboII GAAGA 3 cut(s) 131, 137, 260
MluCI AATT 1 cut(s) 48
MnlI CCTC 1 cut(s) 310
MseI TTAA 3 cut(s) 42, 114, 361
MspCI CTTAAG 1 cut(s) 113
MspI CCGG 1 cut(s) 183
MspR9I CCNGG 2 cut(s) 89, 143
MvaI CCWGG 2 cut(s) 89, 143
NlaIII CATG 1 cut(s) 164
NmuCI GTSAC 1 cut(s) 164
PfeI GAWTC 3 cut(s) 92, 151, 157
PinAI ACCGGT 1 cut(s) 182
Psp6I CCWGG 2 cut(s) 87, 141
PspGI CCWGG 2 cut(s) 87, 141
PspPI GGNCC 1 cut(s) 180
RsaI GTAC 1 cut(s) 282
RsaNI GTAC 1 cut(s) 281
SaqAI TTAA 3 cut(s) 42, 114, 361
Sau96I GGNCC 1 cut(s) 180
ScrFI CCNGG 2 cut(s) 89, 143
SetI ASST 3 cut(s) 147, 232, 238
SfaNI GCATC 1 cut(s) 325
SfcI CTRYAG 1 cut(s) 175
SinI GGWCC 1 cut(s) 180
SmlI CTYRAG 1 cut(s) 113
SmoI CTYRAG 1 cut(s) 113
Sse9I AATT 1 cut(s) 48
StyD4I CCNGG 2 cut(s) 87, 141
TaaI ACNGT 2 cut(s) 193, 224
TaiI ACGT 1 cut(s) 232
TasI AATT 1 cut(s) 48
TfiI GAWTC 3 cut(s) 92, 151, 157
Tru1I TTAA 3 cut(s) 42, 114, 361
Tru9I TTAA 3 cut(s) 42, 114, 361
TseFI GTSAC 1 cut(s) 164
Tsp45I GTSAC 1 cut(s) 164
TspDTI ATGAA 3 cut(s) 138, 250, 261
Vha464I CTTAAG 1 cut(s) 113
VpaK11BI GGWCC 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.