Rorug05G0508500

Small ubiquitin-related modifier

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0011425
Physical Location & Seq
Reverse (-)
69178649 .. 69178930
282 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0508500.1

Sequence Viewer

Length: 282 bp
ATGTCGCCGGAAGAAGAATATTTGAAGACCCAAACAGACTATTGTTTGCAGAATATCGATGCTTTCAAATACGAGTTACCTCCCAAACATAAGATGACCAAGCTGAGGCCCTTTGTCAGAACCTTTCTAAAGGAAGCCAGCAACATGTTTGACATGTACATATACACAGCTGGTTCACGTCCTTACGCATTGAAAATGGTTGAGCTCCTCGGAAAAGACTACTTCGGGTCTAGGGTTATATCTCGTGATGATTTTAATGATAGCTTCAAAATGAGTGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 ko05418 map03013 map05418
Pfam Domains
Protein Families
Rad60-SLD

Protein Analysis

93

Amino Acids

11.03

Weight (kDa)

7.79

Isoelectric Point (pI)

73.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NIF PF03031 30 - 85 1.7e-10 NLI interacting factor-like phosphatase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 158
AfiI CCNNNNNNNGG 1 cut(s) 105
AflIII ACRYGT 2 cut(s) 144, 153
AgsI TTSAA 4 cut(s) 25, 67, 193, 268
AjiI CACGTC 1 cut(s) 179
AluBI AGCT 4 cut(s) 103, 170, 205, 264
AluI AGCT 4 cut(s) 103, 170, 205, 264
Alw21I GWGCWC 1 cut(s) 207
AoxI GGCC 1 cut(s) 107
ArsI GACNNNNNNTTYG 1 cut(s) 261
AspS9I GGNCC 1 cut(s) 108
BanII GRGCYC 1 cut(s) 207
BauI CACGAG 1 cut(s) 243
BbsI GAAGAC 1 cut(s) 32
Bbv12I GWGCWC 1 cut(s) 207
BbvCI CCTCAGC 1 cut(s) 104
BfaI CTAG 2 cut(s) 231, 280
BmgBI CACGTC 1 cut(s) 179
BmgT120I GGNCC 1 cut(s) 108
BmsI GCATC 1 cut(s) 49
BpiI GAAGAC 1 cut(s) 32
Bpu10I CCTNAGC 1 cut(s) 104
Bsa29I ATCGAT 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 208
Bsc4I CCNNNNNNNGG 1 cut(s) 105
BseCI ATCGAT 1 cut(s) 57
BseDI CCNNGG 1 cut(s) 208
BseLI CCNNNNNNNGG 1 cut(s) 105
BseMII CTCAG 1 cut(s) 95
BseRI GAGGAG 1 cut(s) 197
BshFI GGCC 1 cut(s) 109
BshVI ATCGAT 1 cut(s) 57
BsiHKAI GWGCWC 1 cut(s) 207
BsiSI CCGG 1 cut(s) 8
BslI CCNNNNNNNGG 1 cut(s) 105
BsnI GGCC 1 cut(s) 109
Bsp1286I GDGCHC 1 cut(s) 207
Bsp1407I TGTACA 1 cut(s) 156
BspANI GGCC 1 cut(s) 109
BspCNI CTCAG 1 cut(s) 96
BspDI ATCGAT 1 cut(s) 57
BsrGI TGTACA 1 cut(s) 156
BssECI CCNNGG 1 cut(s) 208
BssSI CACGAG 1 cut(s) 243
Bst2BI CACGAG 1 cut(s) 243
BstAUI TGTACA 1 cut(s) 156
BstC8I GCNNGC 1 cut(s) 139
BstDEI CTNAG 1 cut(s) 104
BstNSI RCATGY 2 cut(s) 148, 157
BstV2I GAAGAC 1 cut(s) 32
Bsu15I ATCGAT 1 cut(s) 57
BsuRI GGCC 1 cut(s) 109
BsuTUI ATCGAT 1 cut(s) 57
BtrI CACGTC 1 cut(s) 179
Cac8I GCNNGC 1 cut(s) 139
Cfr13I GGNCC 1 cut(s) 108
ClaI ATCGAT 1 cut(s) 57
Csp6I GTAC 1 cut(s) 157
CviAII CATG 2 cut(s) 145, 154
CviJI RGCY 6 cut(s) 103, 109, 137, 170, 205, 264
CviKI_1 RGCY 6 cut(s) 103, 109, 137, 170, 205, 264
CviQI GTAC 1 cut(s) 157
DdeI CTNAG 1 cut(s) 104
Ecl136II GAGCTC 1 cut(s) 205
Eco24I GRGCYC 1 cut(s) 207
Eco53kI GAGCTC 1 cut(s) 205
EcoICRI GAGCTC 1 cut(s) 205
EcoO109I RGGNCCY 1 cut(s) 108
EcoT38I GRGCYC 1 cut(s) 207
FaeI CATG 2 cut(s) 148, 157
FaiI YATR 6 cut(s) 90, 146, 155, 161, 163, 239
FatI CATG 2 cut(s) 144, 153
FriOI GRGCYC 1 cut(s) 207
FspBI CTAG 2 cut(s) 231, 280
HaeIII GGCC 1 cut(s) 109
HapII CCGG 1 cut(s) 8
Hin1II CATG 2 cut(s) 148, 157
HpaII CCGG 1 cut(s) 8
Hpy166II GTNNAC 1 cut(s) 176
Hpy188I TCNGA 2 cut(s) 119, 212
Hpy188III TCNNGA 1 cut(s) 245
Hpy8I GTNNAC 1 cut(s) 176
HpyCH4IV ACGT 1 cut(s) 178
HpyCH4V TGCA 1 cut(s) 49
HpyF3I CTNAG 1 cut(s) 104
HpySE526I ACGT 1 cut(s) 178
Hsp92II CATG 2 cut(s) 148, 157
LmnI GCTCC 1 cut(s) 210
LpnPI CCDG 3 cut(s) 21, 151, 156
LweI GCATC 1 cut(s) 49
MaeI CTAG 2 cut(s) 231, 280
MaeII ACGT 1 cut(s) 178
MaeIII GTNAC 1 cut(s) 75
MboII GAAGA 3 cut(s) 23, 26, 37
MhlI GDGCHC 1 cut(s) 207
MnlI CCTC 3 cut(s) 90, 99, 218
MseI TTAA 1 cut(s) 255
MspA1I CMGCKG 1 cut(s) 170
MspI CCGG 1 cut(s) 8
NlaIII CATG 2 cut(s) 148, 157
NspI RCATGY 2 cut(s) 148, 157
PciI ACATGT 2 cut(s) 144, 153
PscI ACATGT 2 cut(s) 144, 153
Psp124BI GAGCTC 1 cut(s) 207
PspPI GGNCC 1 cut(s) 108
PvuII CAGCTG 1 cut(s) 170
RsaI GTAC 1 cut(s) 158
RsaNI GTAC 1 cut(s) 157
SacI GAGCTC 1 cut(s) 207
SaqAI TTAA 1 cut(s) 255
Sau96I GGNCC 1 cut(s) 108
SduI GDGCHC 1 cut(s) 207
SetI ASST 7 cut(s) 82, 105, 125, 172, 181, 207, 266
SfaNI GCATC 1 cut(s) 49
SspI AATATT 1 cut(s) 20
SspMI CTAG 2 cut(s) 231, 280
SstI GAGCTC 1 cut(s) 207
TaiI ACGT 1 cut(s) 181
TaqI TCGA 1 cut(s) 57
TatI WGTACW 1 cut(s) 156
Tru1I TTAA 1 cut(s) 255
Tru9I TTAA 1 cut(s) 255
XceI RCATGY 2 cut(s) 148, 157
XspI CTAG 2 cut(s) 231, 280
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.