Rorug01G0178100

chromodomain-helicase-DNA-binding protein 1-like

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
24436961 .. 24439466
2506 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0178100.1

Sequence Viewer

Length: 186 bp
ATGTTGAAGCTACAAGCTTCTGTCAATTCTGGAGGGGCTTTTGGACGACTGTACTCGTATGAAGCAGGTTATGCTCTTAGTTCTGTTAAAGGACGGGTTGCAATGAAATTCTTTGACCTCTCAGAGGCTAGTCAAACCAAAAAATATGCATTTAAGTATCATAGAAAATCAGAGGCCGGAAGGTAA

Protein Analysis

61

Amino Acids

6.79

Weight (kDa)

9.99

Isoelectric Point (pI)

30.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 56
AcsI RAATTY 1 cut(s) 107
AfaI GTAC 1 cut(s) 53
AfiI CCNNNNNNNGG 1 cut(s) 124
AgsI TTSAA 1 cut(s) 7
AluBI AGCT 2 cut(s) 10, 17
AluI AGCT 2 cut(s) 10, 17
AoxI GGCC 1 cut(s) 174
ApoI RAATTY 1 cut(s) 107
BfaI CTAG 1 cut(s) 129
BfuAI ACCTGC 1 cut(s) 56
BpmI CTGGAG 1 cut(s) 51
Bsc4I CCNNNNNNNGG 1 cut(s) 124
Bse3DI GCAATG 1 cut(s) 108
BseLI CCNNNNNNNGG 1 cut(s) 124
BseMI GCAATG 1 cut(s) 108
BseMII CTCAG 1 cut(s) 135
BshFI GGCC 1 cut(s) 176
BsiSI CCGG 1 cut(s) 177
BslI CCNNNNNNNGG 1 cut(s) 124
BsnI GGCC 1 cut(s) 176
BspANI GGCC 1 cut(s) 176
BspCNI CTCAG 1 cut(s) 134
BspMI ACCTGC 1 cut(s) 56
BsrDI GCAATG 1 cut(s) 108
Bst4CI ACNGT 1 cut(s) 51
BstAPI GCANNNNNTGC 1 cut(s) 71
BstDEI CTNAG 2 cut(s) 77, 121
BstENI CCTNNNNNAGG 1 cut(s) 122
BstMWI GCNNNNNNNGC 1 cut(s) 71
BsuRI GGCC 1 cut(s) 176
BveI ACCTGC 1 cut(s) 56
Csp6I GTAC 1 cut(s) 52
CviJI RGCY 5 cut(s) 10, 17, 38, 128, 176
CviKI_1 RGCY 5 cut(s) 10, 17, 38, 128, 176
CviQI GTAC 1 cut(s) 52
DdeI CTNAG 2 cut(s) 77, 121
EcoNI CCTNNNNNAGG 1 cut(s) 122
EcoT22I ATGCAT 1 cut(s) 151
FaiI YATR 4 cut(s) 60, 72, 147, 162
FspBI CTAG 1 cut(s) 129
GsuI CTGGAG 1 cut(s) 51
HaeIII GGCC 1 cut(s) 176
HapII CCGG 1 cut(s) 177
HindIII AAGCTT 1 cut(s) 15
HpaII CCGG 1 cut(s) 177
Hpy188I TCNGA 2 cut(s) 124, 172
Hpy188III TCNNGA 1 cut(s) 30
HpyAV CCTTC 1 cut(s) 174
HpyCH4III ACNGT 1 cut(s) 51
HpyCH4V TGCA 2 cut(s) 101, 149
HpyF10VI GCNNNNNNNGC 1 cut(s) 71
HpyF3I CTNAG 2 cut(s) 77, 121
LpnPI CCDG 2 cut(s) 15, 51
MaeI CTAG 1 cut(s) 129
MluCI AATT 2 cut(s) 25, 107
MnlI CCTC 4 cut(s) 26, 118, 128, 166
Mph1103I ATGCAT 1 cut(s) 151
MseI TTAA 2 cut(s) 87, 153
MspI CCGG 1 cut(s) 177
MwoI GCNNNNNNNGC 1 cut(s) 71
NsiI ATGCAT 1 cut(s) 151
RsaI GTAC 1 cut(s) 53
RsaNI GTAC 1 cut(s) 52
SaqAI TTAA 2 cut(s) 87, 153
SetI ASST 5 cut(s) 12, 19, 70, 120, 185
SgeI CNNG 6 cut(s) 26, 42, 67, 78, 107, 141
Sse9I AATT 2 cut(s) 25, 107
SspMI CTAG 1 cut(s) 129
TaaI ACNGT 1 cut(s) 51
TasI AATT 2 cut(s) 25, 107
TatI WGTACW 1 cut(s) 51
Tru1I TTAA 2 cut(s) 87, 153
Tru9I TTAA 2 cut(s) 87, 153
TspDTI ATGAA 2 cut(s) 75, 119
XagI CCTNNNNNAGG 1 cut(s) 122
XapI RAATTY 1 cut(s) 107
XspI CTAG 1 cut(s) 129
Zsp2I ATGCAT 1 cut(s) 151
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.