Rorug01G0263300

Belongs to the glucose-6-phosphate 1-epimerase family

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
37305801 .. 37307022
1222 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0263300.1

Sequence Viewer

Length: 777 bp
ATGGCCACTGGAGATCCTTGGAGGGGAAATTACCACGCTGGGGCCTCTTTTCTCAAACATATGGAGAAATCAGATTCTGTTCCTCCAATCCCCGACAATCTTTCTTCTTATGGGAAACAATTTTTGAGACGATGTCTGCAAAGGGAACCAAATTTGAGGGCATCTGCATCCCAGTTGCTTGAGGATCCATTCATAACCAGGAAAAACTTCAGGCACCCATCTGGAGCTGGTACAGTTGTTGGAGCTGTTGCTGCCCCCGTCATCCACCAGCAACACGTAGTTACCCCAGCTGCTCCCAAGCAACGCATTGTTACCCCAGCTGCTCCCAAGCAACGGCTTGTTATCCCTGCTGCTCCCAAGCACCGGCTTGTTATTCCCGCTGCTCCCAAGCAACGGCTTGTTATCCCTGCTGCTCCCAAGCAACGGCTTGTTATCCCCGCTGCTCCCAAGCAACTCGTTGTTATCCCCTCTGCTCCCAAGCAACTCGTTGTTATCCCCTCTGCTCCCAAGCAACGCATTGTTACCCCGCTGCTCCCTCCCAAGCAACGGCTTGTTATCCCCGCTGCTCCCAAGCAACTCGTTGTTATCCCCTCTGCTCCCAAGCAACGCATTGTTACCCCGCTGCTCCCTCCCAAGCAACACATGGTTACCCCTGCTGCTCCCAAGCAGCGCATTGTTACCCCATCCACACAACGCGTTGTTCACTCAGTTGCTTCACGTCCTGCTGCTAGTCAACTACCCGACCTCCAGTCCACTCCAGTTCTCATTCACATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

258

Amino Acids

27.9

Weight (kDa)

11.74

Isoelectric Point (pI)

58.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 213
AccII CGCG 1 cut(s) 696
AciI CCGC 5 cut(s) 378, 438, 527, 561, 620
AclWI GGATC 3 cut(s) 8, 179, 192
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 151
AcuI CTGAAG 1 cut(s) 193
AfaI GTAC 1 cut(s) 232
AfiI CCNNNNNNNGG 7 cut(s) 23, 40, 333, 363, 393, 423, 546
AflIII ACRYGT 2 cut(s) 274, 694
AhdI GACNNNNNGTC 1 cut(s) 748
AjiI CACGTC 1 cut(s) 719
AjnI CCWGG 1 cut(s) 197
AluBI AGCT 4 cut(s) 227, 245, 290, 320
AluI AGCT 4 cut(s) 227, 245, 290, 320
Alw26I GTCTC 1 cut(s) 121
AlwI GGATC 3 cut(s) 8, 179, 192
AlwNI CAGNNNCTG 1 cut(s) 77
AoxI GGCC 2 cut(s) 3, 42
ApoI RAATTY 1 cut(s) 151
Asp700I GAANNNNTTC 1 cut(s) 206
AspLEI GCGC 1 cut(s) 672
AspS9I GGNCC 1 cut(s) 42
BaeI ACNNNNGTAYC 2 cut(s) 222, 255
BalI TGGCCA 1 cut(s) 5
BamHI GGATCC 1 cut(s) 184
BanI GGYRCC 1 cut(s) 213
BccI CCATC 2 cut(s) 226, 691
BceAI ACGGC 4 cut(s) 350, 410, 440, 563
BciT130I CCWGG 1 cut(s) 199
BcoDI GTCTC 1 cut(s) 121
BfaI CTAG 1 cut(s) 729
Bme1390I CCNGG 1 cut(s) 199
BmeRI GACNNNNNGTC 1 cut(s) 748
BmgBI CACGTC 1 cut(s) 719
BmgT120I GGNCC 1 cut(s) 42
BmiI GGNNCC 4 cut(s) 43, 147, 186, 215
BmrFI CCNGG 1 cut(s) 199
BmrI ACTGGG 1 cut(s) 166
BmsI GCATC 2 cut(s) 170, 176
BmuI ACTGGG 1 cut(s) 166
BpmI CTGGAG 4 cut(s) 30, 243, 731, 741
BpuEI CTTGAG 1 cut(s) 200
BsaAI YACGTR 1 cut(s) 277
BsaJI CCNNGG 1 cut(s) 17
BsaXI ACNNNNNCTCC 2 cut(s) 729, 759
Bsc4I CCNNNNNNNGG 7 cut(s) 23, 40, 333, 363, 393, 423, 546
Bse118I RCCGGY 1 cut(s) 363
Bse1I ACTGG 4 cut(s) 13, 172, 748, 758
BseBI CCWGG 1 cut(s) 199
BseDI CCNNGG 1 cut(s) 17
BseGI GGATG 3 cut(s) 167, 261, 683
BseLI CCNNNNNNNGG 7 cut(s) 23, 40, 333, 363, 393, 423, 546
BseMII CTCAG 1 cut(s) 720
BseNI ACTGG 4 cut(s) 13, 172, 748, 758
BseYI CCCAGC 3 cut(s) 38, 286, 316
Bsh1236I CGCG 1 cut(s) 696
BshFI GGCC 2 cut(s) 5, 44
BshNI GGYRCC 1 cut(s) 213
BsiSI CCGG 1 cut(s) 364
BslI CCNNNNNNNGG 7 cut(s) 23, 40, 333, 363, 393, 423, 546
BsmAI GTCTC 1 cut(s) 121
BsmBI CGTCTC 1 cut(s) 121
BsnI GGCC 2 cut(s) 5, 44
Bsp143I GATC 2 cut(s) 13, 184
BspACI CCGC 5 cut(s) 378, 438, 527, 561, 620
BspANI GGCC 2 cut(s) 5, 44
BspCNI CTCAG 1 cut(s) 719
BspFNI CGCG 1 cut(s) 696
BspLI GGNNCC 4 cut(s) 43, 147, 186, 215
BspPI GGATC 3 cut(s) 8, 179, 192
BspT107I GGYRCC 1 cut(s) 213
BsrFI RCCGGY 1 cut(s) 363
BsrI ACTGG 4 cut(s) 13, 172, 748, 758
BssAI RCCGGY 1 cut(s) 363
BssECI CCNNGG 1 cut(s) 17
BssMI GATC 2 cut(s) 13, 184
BssT1I CCWWGG 1 cut(s) 17
Bst2UI CCWGG 1 cut(s) 199
Bst4CI ACNGT 1 cut(s) 235
BstBAI YACGTR 1 cut(s) 277
BstDEI CTNAG 1 cut(s) 706
BstEII GGTNACC 1 cut(s) 646
BstF5I GGATG 3 cut(s) 167, 261, 683
BstFNI CGCG 1 cut(s) 696
BstHHI GCGC 1 cut(s) 672
BstKTI GATC 2 cut(s) 16, 187
BstMAI GTCTC 1 cut(s) 121
BstMBI GATC 2 cut(s) 13, 184
BstMWI GCNNNNNNNGC 1 cut(s) 251
BstNI CCWGG 1 cut(s) 199
BstPI GGTNACC 1 cut(s) 646
BstSCI CCNGG 1 cut(s) 197
BstUI CGCG 1 cut(s) 696
BstX2I RGATCY 2 cut(s) 13, 184
BstYI RGATCY 2 cut(s) 13, 184
BsuRI GGCC 2 cut(s) 5, 44
BtrI CACGTC 1 cut(s) 719
BtsCI GGATG 3 cut(s) 167, 261, 683
BtsIMutI CAGTG 1 cut(s) 6
CaiI CAGNNNCTG 1 cut(s) 77
CfoI GCGC 1 cut(s) 672
Cfr10I RCCGGY 1 cut(s) 363
Cfr13I GGNCC 1 cut(s) 42
Csp6I GTAC 1 cut(s) 231
CviAII CATG 1 cut(s) 643
CviQI GTAC 1 cut(s) 231
DdeI CTNAG 1 cut(s) 706
DpnI GATC 2 cut(s) 15, 186
DpnII GATC 2 cut(s) 13, 184
DriI GACNNNNNGTC 1 cut(s) 748
EaeI YGGCCR 1 cut(s) 3
Eam1105I GACNNNNNGTC 1 cut(s) 748
Eco130I CCWWGG 1 cut(s) 17
Eco57I CTGAAG 1 cut(s) 193
Eco91I GGTNACC 1 cut(s) 646
EcoO109I RGGNCCY 1 cut(s) 42
EcoO65I GGTNACC 1 cut(s) 646
EcoRII CCWGG 1 cut(s) 197
EcoT14I CCWWGG 1 cut(s) 17
ErhI CCWWGG 1 cut(s) 17
Esp3I CGTCTC 1 cut(s) 121
FaeI CATG 1 cut(s) 646
FaiI YATR 5 cut(s) 60, 62, 111, 194, 644
FatI CATG 1 cut(s) 642
FauI CCCGC 5 cut(s) 385, 445, 534, 568, 627
FauNDI CATATG 1 cut(s) 60
FokI GGATG 3 cut(s) 154, 248, 670
FspBI CTAG 1 cut(s) 729
GlaI GCGC 1 cut(s) 671
GsaI CCCAGC 3 cut(s) 42, 290, 320
GsuI CTGGAG 4 cut(s) 30, 243, 731, 741
HaeIII GGCC 2 cut(s) 5, 44
HapII CCGG 1 cut(s) 364
HhaI GCGC 1 cut(s) 672
Hin1II CATG 1 cut(s) 646
Hin6I GCGC 1 cut(s) 670
HinP1I GCGC 1 cut(s) 670
HincII GTYRAC 1 cut(s) 734
HindII GTYRAC 1 cut(s) 734
HinfI GANTC 1 cut(s) 74
HpaII CCGG 1 cut(s) 364
Hpy166II GTNNAC 3 cut(s) 703, 734, 753
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 1 cut(s) 222
Hpy8I GTNNAC 3 cut(s) 703, 734, 753
HpyCH4III ACNGT 1 cut(s) 235
HpyCH4IV ACGT 2 cut(s) 276, 718
HpyCH4V TGCA 2 cut(s) 139, 167
HpyF10VI GCNNNNNNNGC 1 cut(s) 251
HpyF3I CTNAG 1 cut(s) 706
HpySE526I ACGT 2 cut(s) 276, 718
Hsp92II CATG 1 cut(s) 646
HspAI GCGC 1 cut(s) 670
Kzo9I GATC 2 cut(s) 13, 184
LweI GCATC 2 cut(s) 170, 176
MaeI CTAG 1 cut(s) 729
MaeII ACGT 2 cut(s) 276, 718
MaeIII GTNAC 6 cut(s) 280, 310, 520, 613, 646, 676
MalI GATC 2 cut(s) 15, 186
MboI GATC 2 cut(s) 13, 184
MboII GAAGA 1 cut(s) 96
MflI RGATCY 2 cut(s) 13, 184
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 3 cut(s) 28, 119, 151
MluI ACGCGT 1 cut(s) 694
MluNI TGGCCA 1 cut(s) 5
MmeI TCCRAC 1 cut(s) 220
Mox20I TGGCCA 1 cut(s) 5
MroXI GAANNNNTTC 1 cut(s) 206
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspA1I CMGCKG 7 cut(s) 290, 320, 380, 440, 529, 563, 622
MspI CCGG 1 cut(s) 364
MspR9I CCNGG 1 cut(s) 199
MvaI CCWGG 1 cut(s) 199
MvnI CGCG 1 cut(s) 696
MwoI GCNNNNNNNGC 1 cut(s) 251
NdeI CATATG 1 cut(s) 60
NdeII GATC 2 cut(s) 13, 184
NlaIII CATG 1 cut(s) 646
NlaIV GGNNCC 4 cut(s) 43, 147, 186, 215
PdmI GAANNNNTTC 1 cut(s) 206
PfeI GAWTC 1 cut(s) 74
PflFI GACNNNGTC 1 cut(s) 132
Ppu21I YACGTR 1 cut(s) 277
Psp6I CCWGG 1 cut(s) 197
PspEI GGTNACC 1 cut(s) 646
PspFI CCCAGC 3 cut(s) 38, 286, 316
PspGI CCWGG 1 cut(s) 197
PspN4I GGNNCC 4 cut(s) 43, 147, 186, 215
PspPI GGNCC 1 cut(s) 42
PstNI CAGNNNCTG 1 cut(s) 77
PsuI RGATCY 2 cut(s) 13, 184
PsyI GACNNNGTC 1 cut(s) 132
PvuII CAGCTG 2 cut(s) 290, 320
RsaI GTAC 1 cut(s) 232
RsaNI GTAC 1 cut(s) 231
Sau3AI GATC 2 cut(s) 13, 184
Sau96I GGNCC 1 cut(s) 42
ScrFI CCNGG 1 cut(s) 199
SetI ASST 7 cut(s) 229, 247, 279, 292, 322, 721, 747
SfaNI GCATC 2 cut(s) 170, 176
SmlI CTYRAG 1 cut(s) 179
SmoI CTYRAG 1 cut(s) 179
Sse9I AATT 3 cut(s) 28, 119, 151
SsiI CCGC 5 cut(s) 378, 438, 527, 561, 620
SspMI CTAG 1 cut(s) 729
StyD4I CCNGG 1 cut(s) 197
StyI CCWWGG 1 cut(s) 17
TaaI ACNGT 1 cut(s) 235
TaiI ACGT 2 cut(s) 279, 721
TasI AATT 3 cut(s) 28, 119, 151
TfiI GAWTC 1 cut(s) 74
TscAI CASTG 1 cut(s) 13
TspDTI ATGAA 1 cut(s) 181
TspRI CASTG 1 cut(s) 13
Tth111I GACNNNGTC 1 cut(s) 132
XapI RAATTY 1 cut(s) 151
XcmI CCANNNNNNNNNTGG 1 cut(s) 640
XmnI GAANNNNTTC 1 cut(s) 206
XspI CTAG 1 cut(s) 729
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.