Rorug01G0412100

membrane-associated kinase regulator

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
Physical Location & Seq
Reverse (-)
51708688 .. 51708840
153 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0412100.1

Sequence Viewer

Length: 153 bp
ATGAACAATAAGGTAGTCTCTTCAGTAGTAAACATTGATATGGGTATTTATAATATGGGCAACGCGTCAATCAACCGAGAATTTGGCAAATCCTTCAATCATGGTTTTAAAGGTAGGAGGGGATCGCATTTACGGATTCAACCAAGTTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.61

Weight (kDa)

11.0

Isoelectric Point (pI)

34.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 51
AccII CGCG 1 cut(s) 65
AclWI GGATC 1 cut(s) 130
AcsI RAATTY 1 cut(s) 80
AcuI CTGAAG 1 cut(s) 6
AflIII ACRYGT 1 cut(s) 63
AgsI TTSAA 2 cut(s) 97, 140
Alw26I GTCTC 1 cut(s) 22
AlwI GGATC 1 cut(s) 130
ApoI RAATTY 1 cut(s) 80
BcoDI GTCTC 1 cut(s) 22
Bsh1236I CGCG 1 cut(s) 65
BsmAI GTCTC 1 cut(s) 22
Bsp143I GATC 1 cut(s) 122
BspFNI CGCG 1 cut(s) 65
BspPI GGATC 1 cut(s) 130
BssMI GATC 1 cut(s) 122
Bst6I CTCTTC 1 cut(s) 25
BstFNI CGCG 1 cut(s) 65
BstKTI GATC 1 cut(s) 125
BstMAI GTCTC 1 cut(s) 22
BstMBI GATC 1 cut(s) 122
BstUI CGCG 1 cut(s) 65
CseI GACGC 1 cut(s) 54
CviAII CATG 1 cut(s) 101
DpnI GATC 1 cut(s) 124
DpnII GATC 1 cut(s) 122
DraI TTTAAA 1 cut(s) 109
Eam1104I CTCTTC 1 cut(s) 25
EarI CTCTTC 1 cut(s) 25
Eco57I CTGAAG 1 cut(s) 6
FaeI CATG 1 cut(s) 104
FaiI YATR 4 cut(s) 41, 51, 56, 102
FatI CATG 1 cut(s) 100
HgaI GACGC 1 cut(s) 54
Hin1II CATG 1 cut(s) 104
HinfI GANTC 1 cut(s) 136
Hpy166II GTNNAC 1 cut(s) 31
Hpy8I GTNNAC 1 cut(s) 31
HpyAV CCTTC 1 cut(s) 103
Hsp92II CATG 1 cut(s) 104
Kzo9I GATC 1 cut(s) 122
MalI GATC 1 cut(s) 124
MboI GATC 1 cut(s) 122
MboII GAAGA 1 cut(s) 12
MluCI AATT 1 cut(s) 80
MluI ACGCGT 1 cut(s) 63
MnlI CCTC 1 cut(s) 111
MseI TTAA 2 cut(s) 108, 151
MslI CAYNNNNRTG 1 cut(s) 38
MvnI CGCG 1 cut(s) 65
NdeII GATC 1 cut(s) 122
NlaIII CATG 1 cut(s) 104
PfeI GAWTC 1 cut(s) 136
PsiI TTATAA 1 cut(s) 51
RseI CAYNNNNRTG 1 cut(s) 38
SaqAI TTAA 2 cut(s) 108, 151
Sau3AI GATC 1 cut(s) 122
SetI ASST 2 cut(s) 15, 115
SgeI CNNG 3 cut(s) 76, 89, 113
SmiMI CAYNNNNRTG 1 cut(s) 38
Sse9I AATT 1 cut(s) 80
TasI AATT 1 cut(s) 80
TfiI GAWTC 1 cut(s) 136
Tru1I TTAA 2 cut(s) 108, 151
Tru9I TTAA 2 cut(s) 108, 151
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 148
XapI RAATTY 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.