Rorug02G0210200

At5g64816-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0005024
Physical Location & Seq
Reverse (-)
19730717 .. 19731142
426 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0210200.1

Sequence Viewer

Length: 243 bp
ATGGCCAAGATGACTAGGTTTACAATTGCAACCTTTTTTCTTGTGCTGATGCTCTTGCTGAGCACAGCAAGTGCTCAAGGTTCAAGGTGTTGCGCCAATTATCCCAAGCTTGGAAGTTGTGTGCCTGGCACAGATGACAACCCAGAGAAAAATGGAAAGTGCTGGGTGTATTGCATTGAAGAGTGTAAAGGAGGAATCTGCAAAAACGTAGGCTCTCATCATGAGTGTCATTGCATGTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.75

Weight (kDa)

8.05

Isoelectric Point (pI)

50.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Defensin_like PF10868 29 - 80 1.7e-10 Cysteine-rich antifungal protein 2, defensin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 3
AfiI CCNNNNNNNGG 1 cut(s) 110
AgsI TTSAA 2 cut(s) 84, 179
AjnI CCWGG 1 cut(s) 124
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
Alw21I GWGCWC 2 cut(s) 65, 76
AoxI GGCC 1 cut(s) 3
AspLEI GCGC 1 cut(s) 95
BalI TGGCCA 1 cut(s) 5
Bbv12I GWGCWC 2 cut(s) 65, 76
BciT130I CCWGG 1 cut(s) 126
BfaI CTAG 1 cut(s) 15
BlpI GCTNAGC 1 cut(s) 59
Bme1390I CCNGG 1 cut(s) 126
BmrFI CCNGG 1 cut(s) 126
BmsI GCATC 1 cut(s) 39
Bpu1102I GCTNAGC 1 cut(s) 59
BpuEI CTTGAG 1 cut(s) 60
Bsc4I CCNNNNNNNGG 1 cut(s) 110
Bse3DI GCAATG 1 cut(s) 229
BseBI CCWGG 1 cut(s) 126
BseLI CCNNNNNNNGG 1 cut(s) 110
BseMI GCAATG 1 cut(s) 229
BseMII CTCAG 1 cut(s) 50
BseYI CCCAGC 1 cut(s) 162
BshFI GGCC 1 cut(s) 5
BsiHKAI GWGCWC 2 cut(s) 65, 76
BslI CCNNNNNNNGG 1 cut(s) 110
BsnI GGCC 1 cut(s) 5
Bsp1286I GDGCHC 2 cut(s) 65, 76
Bsp1720I GCTNAGC 1 cut(s) 59
BspANI GGCC 1 cut(s) 5
BspCNI CTCAG 1 cut(s) 51
BspHI TCATGA 1 cut(s) 220
BsrDI GCAATG 1 cut(s) 229
Bst2UI CCWGG 1 cut(s) 126
Bst6I CTCTTC 1 cut(s) 174
BstDEI CTNAG 1 cut(s) 59
BstHHI GCGC 1 cut(s) 95
BstNI CCWGG 1 cut(s) 126
BstNSI RCATGY 1 cut(s) 238
BstSCI CCNGG 1 cut(s) 124
BsuRI GGCC 1 cut(s) 5
CciI TCATGA 1 cut(s) 220
CfoI GCGC 1 cut(s) 95
CviAII CATG 2 cut(s) 221, 235
CviJI RGCY 3 cut(s) 5, 109, 213
CviKI_1 RGCY 3 cut(s) 5, 109, 213
DdeI CTNAG 1 cut(s) 59
EaeI YGGCCR 1 cut(s) 3
Eam1104I CTCTTC 1 cut(s) 174
EarI CTCTTC 1 cut(s) 174
EcoRII CCWGG 1 cut(s) 124
FaeI CATG 2 cut(s) 224, 238
FaiI YATR 2 cut(s) 222, 236
FatI CATG 2 cut(s) 220, 234
FspBI CTAG 1 cut(s) 15
GlaI GCGC 1 cut(s) 94
GsaI CCCAGC 1 cut(s) 166
HaeIII GGCC 1 cut(s) 5
HhaI GCGC 1 cut(s) 95
Hin1II CATG 2 cut(s) 224, 238
Hin6I GCGC 1 cut(s) 93
HinP1I GCGC 1 cut(s) 93
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 1 cut(s) 195
Hpy166II GTNNAC 1 cut(s) 21
Hpy188III TCNNGA 1 cut(s) 221
Hpy8I GTNNAC 1 cut(s) 21
HpyCH4IV ACGT 1 cut(s) 207
HpyCH4V TGCA 4 cut(s) 29, 174, 201, 234
HpyF3I CTNAG 1 cut(s) 59
HpySE526I ACGT 1 cut(s) 207
Hsp92II CATG 2 cut(s) 224, 238
HspAI GCGC 1 cut(s) 93
LpnPI CCDG 4 cut(s) 111, 138, 148, 156
LweI GCATC 1 cut(s) 39
MaeI CTAG 1 cut(s) 15
MaeII ACGT 1 cut(s) 207
MboII GAAGA 1 cut(s) 191
MfeI CAATTG 1 cut(s) 24
MhlI GDGCHC 2 cut(s) 65, 76
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 2 cut(s) 24, 97
MluNI TGGCCA 1 cut(s) 5
MnlI CCTC 1 cut(s) 185
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
Msp20I TGGCCA 1 cut(s) 5
MspR9I CCNGG 1 cut(s) 126
MunI CAATTG 1 cut(s) 24
MvaI CCWGG 1 cut(s) 126
NlaIII CATG 2 cut(s) 224, 238
NspI RCATGY 1 cut(s) 238
PagI TCATGA 1 cut(s) 220
PfeI GAWTC 1 cut(s) 195
Psp6I CCWGG 1 cut(s) 124
PspFI CCCAGC 1 cut(s) 162
PspGI CCWGG 1 cut(s) 124
ScrFI CCNGG 1 cut(s) 126
SduI GDGCHC 2 cut(s) 65, 76
SetI ASST 6 cut(s) 20, 35, 82, 89, 111, 210
SfaNI GCATC 1 cut(s) 39
SmlI CTYRAG 1 cut(s) 75
SmoI CTYRAG 1 cut(s) 75
Sse9I AATT 2 cut(s) 24, 97
SspMI CTAG 1 cut(s) 15
StyD4I CCNGG 1 cut(s) 124
TaiI ACGT 1 cut(s) 210
TasI AATT 2 cut(s) 24, 97
TfiI GAWTC 1 cut(s) 195
XceI RCATGY 1 cut(s) 238
XspI CTAG 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.