Rorug02G0239700

Lipase (class 3)

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
24560311 .. 24560523
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0239700.1

Sequence Viewer

Length: 213 bp
ATGTCGTCAACATTTATCACAAGTCCTCTTTCTGGTGTCTTTCAGCATTCAAGCAATGCACCATCTTCTTTGTCCTCGTGTTTAGCTAGTTTAAGCTCCTGTTCTGATGTTATACCACCTTATTCATCTGGTGGGTACAATTTTCAAGGGCAGGCTAGGGTGATACTAGTTCAGCAAATTGTGTCCCTCATCGTCTACCACCGCAAGGCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.41

Weight (kDa)

8.8

Isoelectric Point (pI)

62.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011011)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 195
AciI CCGC 1 cut(s) 202
AfaI GTAC 1 cut(s) 137
AfiI CCNNNNNNNGG 2 cut(s) 32, 205
AgsI TTSAA 2 cut(s) 51, 146
AhlI ACTAGT 1 cut(s) 166
AluBI AGCT 2 cut(s) 86, 96
AluI AGCT 2 cut(s) 86, 96
AsuHPI GGTGA 1 cut(s) 172
BauI CACGAG 1 cut(s) 76
BccI CCATC 1 cut(s) 70
BcuI ACTAGT 1 cut(s) 166
BfaI CTAG 3 cut(s) 87, 156, 167
Bsc4I CCNNNNNNNGG 2 cut(s) 32, 205
Bse3DI GCAATG 1 cut(s) 61
BseLI CCNNNNNNNGG 2 cut(s) 32, 205
BseMI GCAATG 1 cut(s) 61
BslFI GGGAC 1 cut(s) 169
BslI CCNNNNNNNGG 2 cut(s) 32, 205
BsmFI GGGAC 1 cut(s) 169
BsmI GAATGC 1 cut(s) 46
BspACI CCGC 1 cut(s) 202
BsrDI GCAATG 1 cut(s) 61
BssSI CACGAG 1 cut(s) 76
Bst2BI CACGAG 1 cut(s) 76
BstC8I GCNNGC 1 cut(s) 153
Cac8I GCNNGC 1 cut(s) 153
Csp6I GTAC 1 cut(s) 136
CviJI RGCY 3 cut(s) 86, 96, 155
CviKI_1 RGCY 3 cut(s) 86, 96, 155
CviQI GTAC 1 cut(s) 136
FaiI YATR 1 cut(s) 113
FaqI GGGAC 1 cut(s) 169
FblI GTMKAC 1 cut(s) 195
FspBI CTAG 3 cut(s) 87, 156, 167
HincII GTYRAC 1 cut(s) 9
HindII GTYRAC 1 cut(s) 9
HphI GGTGA 1 cut(s) 172
Hpy166II GTNNAC 2 cut(s) 9, 196
Hpy188I TCNGA 1 cut(s) 106
Hpy8I GTNNAC 2 cut(s) 9, 196
HpyCH4V TGCA 1 cut(s) 59
LmnI GCTCC 1 cut(s) 101
LpnPI CCDG 4 cut(s) 18, 112, 114, 137
MaeI CTAG 3 cut(s) 87, 156, 167
MboII GAAGA 1 cut(s) 57
MluCI AATT 2 cut(s) 139, 177
MnlI CCTC 3 cut(s) 36, 85, 197
MseI TTAA 1 cut(s) 92
Mva1269I GAATGC 1 cut(s) 46
PctI GAATGC 1 cut(s) 46
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
SaqAI TTAA 1 cut(s) 92
SetI ASST 3 cut(s) 88, 98, 121
SpeI ACTAGT 1 cut(s) 166
Sse9I AATT 2 cut(s) 139, 177
SsiI CCGC 1 cut(s) 202
SspMI CTAG 3 cut(s) 87, 156, 167
TasI AATT 2 cut(s) 139, 177
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
TspDTI ATGAA 1 cut(s) 114
XmiI GTMKAC 1 cut(s) 195
XspI CTAG 3 cut(s) 87, 156, 167
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.