Rorug02G0557400

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
68404383 .. 68405565
1183 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0557400.1

Sequence Viewer

Length: 210 bp
ATGGTCATGATGATGGGGTTGGATAGGTTGGTCGGGAATTTGAAGTCCAAGTTCAGGTCCTTTAAGATGAAGAAACCAGCTACGGATTACAACAAGATCGAAAAGAGCGATAGCATGAGAGTCGAAATAAGAAGCAAGAAGGCCAGAAAGCTCATTGAGAAGACACTGAAAGTTGCAGACTCTCCCAAGACGAAAACTTTCGCTTTTTGA

Protein Analysis

69

Amino Acids

8.03

Weight (kDa)

10.42

Isoelectric Point (pI)

46.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 54
AgsI TTSAA 1 cut(s) 43
AluBI AGCT 2 cut(s) 80, 151
AluI AGCT 2 cut(s) 80, 151
AoxI GGCC 1 cut(s) 141
ApoI RAATTY 1 cut(s) 37
Asp700I GAANNNNTTC 1 cut(s) 197
AspS9I GGNCC 1 cut(s) 57
AvaII GGWCC 1 cut(s) 57
BbsI GAAGAC 1 cut(s) 167
BccI CCATC 1 cut(s) 7
BcgI CGANNNNNNTGC 2 cut(s) 103, 137
Bme18I GGWCC 1 cut(s) 57
BmgT120I GGNCC 1 cut(s) 57
BpiI GAAGAC 1 cut(s) 167
Bsc4I CCNNNNNNNGG 1 cut(s) 54
BseLI CCNNNNNNNGG 1 cut(s) 54
BshFI GGCC 1 cut(s) 143
BslI CCNNNNNNNGG 1 cut(s) 54
BsnI GGCC 1 cut(s) 143
Bsp143I GATC 1 cut(s) 96
BspANI GGCC 1 cut(s) 143
BspHI TCATGA 1 cut(s) 6
BssMI GATC 1 cut(s) 96
BstKTI GATC 1 cut(s) 99
BstMBI GATC 1 cut(s) 96
BstV2I GAAGAC 1 cut(s) 167
BsuRI GGCC 1 cut(s) 143
BtsIMutI CAGTG 1 cut(s) 164
CciI TCATGA 1 cut(s) 6
Cfr13I GGNCC 1 cut(s) 57
CviAII CATG 2 cut(s) 7, 115
CviJI RGCY 3 cut(s) 80, 143, 151
CviKI_1 RGCY 3 cut(s) 80, 143, 151
DpnI GATC 1 cut(s) 98
DpnII GATC 1 cut(s) 96
Eco47I GGWCC 1 cut(s) 57
EcoO109I RGGNCCY 1 cut(s) 57
FaeI CATG 2 cut(s) 10, 118
FaiI YATR 2 cut(s) 8, 116
FatI CATG 2 cut(s) 6, 114
HaeIII GGCC 1 cut(s) 143
Hin1II CATG 2 cut(s) 10, 118
HinfI GANTC 2 cut(s) 120, 179
Hpy188III TCNNGA 2 cut(s) 7, 34
HpyAV CCTTC 1 cut(s) 133
HpyCH4V TGCA 1 cut(s) 176
Hsp92II CATG 2 cut(s) 10, 118
Kzo9I GATC 1 cut(s) 96
LpnPI CCDG 3 cut(s) 40, 90, 157
MalI GATC 1 cut(s) 98
MboI GATC 1 cut(s) 96
MboII GAAGA 2 cut(s) 82, 172
MluCI AATT 1 cut(s) 37
MlyI GAGTC 2 cut(s) 129, 173
MroXI GAANNNNTTC 1 cut(s) 197
MseI TTAA 1 cut(s) 63
MslI CAYNNNNRTG 1 cut(s) 11
NdeII GATC 1 cut(s) 96
NlaIII CATG 2 cut(s) 10, 118
PagI TCATGA 1 cut(s) 6
PcsI WCGNNNNNNNCGW 1 cut(s) 105
PdmI GAANNNNTTC 1 cut(s) 197
PleI GAGTC 2 cut(s) 128, 173
PpsI GAGTC 2 cut(s) 128, 173
PpuMI RGGWCCY 1 cut(s) 57
Psp5II RGGWCCY 1 cut(s) 57
PspPI GGNCC 1 cut(s) 57
PspPPI RGGWCCY 1 cut(s) 57
RseI CAYNNNNRTG 1 cut(s) 11
SaqAI TTAA 1 cut(s) 63
Sau3AI GATC 1 cut(s) 96
Sau96I GGNCC 1 cut(s) 57
SchI GAGTC 2 cut(s) 129, 173
SetI ASST 4 cut(s) 29, 59, 82, 153
SinI GGWCC 1 cut(s) 57
SmiMI CAYNNNNRTG 1 cut(s) 11
Sse9I AATT 1 cut(s) 37
TaqI TCGA 2 cut(s) 99, 123
TasI AATT 1 cut(s) 37
Tru1I TTAA 1 cut(s) 63
Tru9I TTAA 1 cut(s) 63
TscAI CASTG 1 cut(s) 171
TspDTI ATGAA 1 cut(s) 83
TspGWI ACGGA 1 cut(s) 98
TspRI CASTG 1 cut(s) 171
VpaK11BI GGWCC 1 cut(s) 57
XapI RAATTY 1 cut(s) 37
XmnI GAANNNNTTC 1 cut(s) 197
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.