Rorug02G0598700

acetate--CoA ligase ACS, chloroplastic

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
71920652 .. 71921411
760 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0598700.1

Sequence Viewer

Length: 306 bp
ATGCCTAAATCTAATGTAGAGGATGCCATTTATTGTTTGAAGAAATTGATTGAAGCTCTAGAGATTGCGAAGGAGGAGGCAAGAGTGAAGGCTGAGGAAGAAGCAAGCAAGAAGGCAGTTAAAGATGCAAAAGTGAATGCAAAGAAAGAAGCAAAATTGAAGGCAGAGGAAGAAGCAAAATTGAAGGCAGAGAAAGCAGGGAAGAAAACAGAGGAGTCTGCTAAAGATGAAGAGAAATGTATCGGAACATCAGGTAAACAAGATGCGAAAGAAAATGGAGTTATTGAAAATGAGGAAAAGAGTTGA

Protein Analysis

101

Amino Acids

11.11

Weight (kDa)

5.76

Isoelectric Point (pI)

52.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 5 cut(s) 40, 53, 160, 184, 287
AluBI AGCT 1 cut(s) 56
AluI AGCT 1 cut(s) 56
BbvCI CCTCAGC 1 cut(s) 93
BfaI CTAG 1 cut(s) 59
BmsI GCATC 3 cut(s) 13, 115, 253
Bpu10I CCTNAGC 1 cut(s) 93
BseGI GGATG 1 cut(s) 28
BseMII CTCAG 1 cut(s) 84
BseRI GAGGAG 2 cut(s) 89, 227
BsmI GAATGC 1 cut(s) 142
BspCNI CTCAG 1 cut(s) 85
Bst6I CTCTTC 1 cut(s) 225
BstC8I GCNNGC 1 cut(s) 106
BstDEI CTNAG 1 cut(s) 93
BstF5I GGATG 1 cut(s) 28
BstMWI GCNNNNNNNGC 1 cut(s) 194
BtsCI GGATG 1 cut(s) 28
Cac8I GCNNGC 1 cut(s) 106
CviJI RGCY 2 cut(s) 56, 92
CviKI_1 RGCY 2 cut(s) 56, 92
DdeI CTNAG 1 cut(s) 93
Eam1104I CTCTTC 1 cut(s) 225
EarI CTCTTC 1 cut(s) 225
FokI GGATG 1 cut(s) 35
FspBI CTAG 1 cut(s) 59
HinfI GANTC 1 cut(s) 215
Hpy166II GTNNAC 1 cut(s) 257
Hpy188I TCNGA 1 cut(s) 245
Hpy188III TCNNGA 1 cut(s) 59
Hpy8I GTNNAC 1 cut(s) 257
HpyAV CCTTC 5 cut(s) 64, 82, 106, 154, 178
HpyCH4V TGCA 2 cut(s) 128, 140
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 1 cut(s) 93
LpnPI CCDG 2 cut(s) 183, 237
LweI GCATC 3 cut(s) 13, 115, 253
MaeI CTAG 1 cut(s) 59
MboII GAAGA 5 cut(s) 52, 110, 182, 214, 242
MluCI AATT 3 cut(s) 44, 155, 179
MlyI GAGTC 1 cut(s) 224
MnlI CCTC 7 cut(s) 13, 67, 70, 88, 160, 205, 286
MseI TTAA 1 cut(s) 120
Mva1269I GAATGC 1 cut(s) 142
MwoI GCNNNNNNNGC 1 cut(s) 194
PctI GAATGC 1 cut(s) 142
PleI GAGTC 1 cut(s) 223
PpsI GAGTC 1 cut(s) 223
SaqAI TTAA 1 cut(s) 120
SchI GAGTC 1 cut(s) 224
SetI ASST 2 cut(s) 58, 256
SfaNI GCATC 3 cut(s) 13, 115, 253
SgeI CNNG 7 cut(s) 71, 93, 117, 121, 210, 264, 272
Sse9I AATT 3 cut(s) 44, 155, 179
SspMI CTAG 1 cut(s) 59
TasI AATT 3 cut(s) 44, 155, 179
Tru1I TTAA 1 cut(s) 120
Tru9I TTAA 1 cut(s) 120
TspDTI ATGAA 1 cut(s) 243
XbaI TCTAGA 1 cut(s) 58
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.