Rorug04G0144200

Long chain acyl-CoA synthetase

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
24013307 .. 24018180
4874 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0144200.1

Sequence Viewer

Length: 222 bp
ATGAAGGAGATGCAGAGGTCGAAGGAGGGACAGATGAAGAAGATGCAGAGGAAGAAGACGGAGGTTTCAAAGTTGGGAAAGTTGAAATGTAGGGATGAACATGATTCTGTACAAGATGTAAAAGCAGATGACCTACGGCAGATGCTTCTAGCCATGACAGAGGAGGGGTTGGCTGTTGTTGCAATATTGAGGCACTTTAGATACCCTTGCAGGTTCATTTAG

Protein Analysis

73

Amino Acids

8.64

Weight (kDa)

9.64

Isoelectric Point (pI)

37.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 201
AfaI GTAC 1 cut(s) 111
AgsI TTSAA 2 cut(s) 69, 85
BbsI GAAGAC 1 cut(s) 62
BceAI ACGGC 1 cut(s) 152
BfaI CTAG 1 cut(s) 149
BfuAI ACCTGC 1 cut(s) 201
BmsI GCATC 2 cut(s) 33, 132
BpiI GAAGAC 1 cut(s) 62
BseGI GGATG 1 cut(s) 100
BseRI GAGGAG 1 cut(s) 176
BslFI GGGAC 1 cut(s) 42
BsmFI GGGAC 1 cut(s) 42
Bsp1407I TGTACA 1 cut(s) 109
BspMI ACCTGC 1 cut(s) 201
BsrGI TGTACA 1 cut(s) 109
BstAUI TGTACA 1 cut(s) 109
BstF5I GGATG 1 cut(s) 100
BstMWI GCNNNNNNNGC 1 cut(s) 179
BstV2I GAAGAC 1 cut(s) 62
BtsCI GGATG 1 cut(s) 100
BveI ACCTGC 1 cut(s) 201
Csp6I GTAC 1 cut(s) 110
CviAII CATG 2 cut(s) 101, 154
CviJI RGCY 2 cut(s) 152, 173
CviKI_1 RGCY 2 cut(s) 152, 173
CviQI GTAC 1 cut(s) 110
FaeI CATG 2 cut(s) 104, 157
FaiI YATR 2 cut(s) 102, 155
FaqI GGGAC 1 cut(s) 42
FatI CATG 2 cut(s) 100, 153
FokI GGATG 1 cut(s) 107
FspBI CTAG 1 cut(s) 149
Hin1II CATG 2 cut(s) 104, 157
HinfI GANTC 1 cut(s) 104
HpyAV CCTTC 1 cut(s) 16
HpyCH4V TGCA 4 cut(s) 13, 46, 182, 210
HpyF10VI GCNNNNNNNGC 1 cut(s) 179
Hsp92II CATG 2 cut(s) 104, 157
LpnPI CCDG 1 cut(s) 196
LweI GCATC 2 cut(s) 33, 132
MaeI CTAG 1 cut(s) 149
MboII GAAGA 4 cut(s) 49, 52, 64, 67
MnlI CCTC 7 cut(s) 9, 19, 42, 55, 154, 157, 183
MwoI GCNNNNNNNGC 1 cut(s) 179
NlaIII CATG 2 cut(s) 104, 157
PfeI GAWTC 1 cut(s) 104
RsaI GTAC 1 cut(s) 111
RsaNI GTAC 1 cut(s) 110
SetI ASST 4 cut(s) 20, 66, 135, 215
SfaNI GCATC 2 cut(s) 33, 132
SgeI CNNG 4 cut(s) 113, 125, 161, 166
SspI AATATT 1 cut(s) 186
SspMI CTAG 1 cut(s) 149
TaqI TCGA 1 cut(s) 20
TatI WGTACW 1 cut(s) 109
TfiI GAWTC 1 cut(s) 104
TspDTI ATGAA 4 cut(s) 17, 50, 111, 205
TspGWI ACGGA 1 cut(s) 74
XspI CTAG 1 cut(s) 149
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.