Rh1DG027400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Reverse (-)
4149129 .. 4149553
425 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG027400.1

Sequence Viewer

Length: 339 bp
ATGGTGGATTGGGGTTTGGTCTTGGCAACAGCAACTCCACAGGTTCGTTTCGTTGTTATGGGCAACATCAAAGACGGAGAATTTGCTTTCAGTTGGAATGCAACCACACTCGATCATCAAGGTTTTTCTATCCTCACCATTCTAGATTGTTACTTCAATTCTTTTTGGAGAGACATTTGGTTTTCTTTTGTTTGGTTACTGAGAGAAATAGATGCTTTATTGCTAATTCCTGTGTTAATCTTCACAATACTTCTGTTATGGGCATCAACCCCGAAACCTGACAATTTCTGCAGCCATGTTGTAAGAATCATCTACCTCATAACTTTTATGAATAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

13.02

Weight (kDa)

4.99

Isoelectric Point (pI)

21.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 80
AgsI TTSAA 1 cut(s) 157
Alw26I GTCTC 1 cut(s) 165
ApeKI GCWGC 1 cut(s) 291
ApoI RAATTY 1 cut(s) 80
ArsI GACNNNNNNTTYG 2 cut(s) 65, 97
AsuHPI GGTGA 1 cut(s) 127
BbvI GCAGC 1 cut(s) 303
BcoDI GTCTC 1 cut(s) 165
BfaI CTAG 1 cut(s) 143
BfmI CTRYAG 1 cut(s) 289
BisI GCNGC 1 cut(s) 292
BlsI GCNGC 1 cut(s) 293
BmsI GCATC 2 cut(s) 202, 272
BsaXI ACNNNNNCTCC 2 cut(s) 19, 49
BseMII CTCAG 1 cut(s) 191
BseXI GCAGC 1 cut(s) 303
BsmAI GTCTC 1 cut(s) 165
BsmI GAATGC 1 cut(s) 103
Bsp143I GATC 1 cut(s) 112
BspCNI CTCAG 1 cut(s) 192
BspMAI CTGCAG 1 cut(s) 293
BssMI GATC 1 cut(s) 112
BstDEI CTNAG 1 cut(s) 200
BstKTI GATC 1 cut(s) 115
BstMAI GTCTC 1 cut(s) 165
BstMBI GATC 1 cut(s) 112
BstSFI CTRYAG 1 cut(s) 289
BstV1I GCAGC 1 cut(s) 303
CviAII CATG 1 cut(s) 296
CviJI RGCY 1 cut(s) 294
CviKI_1 RGCY 1 cut(s) 294
DdeI CTNAG 1 cut(s) 200
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
FaeI CATG 1 cut(s) 299
FaiI YATR 5 cut(s) 59, 259, 297, 320, 329
FatI CATG 1 cut(s) 295
Fnu4HI GCNGC 1 cut(s) 292
Fsp4HI GCNGC 1 cut(s) 292
FspBI CTAG 1 cut(s) 143
GluI GCNGC 1 cut(s) 292
Hin1II CATG 1 cut(s) 299
HinfI GANTC 1 cut(s) 306
HphI GGTGA 1 cut(s) 127
Hpy188III TCNNGA 1 cut(s) 143
HpyCH4V TGCA 2 cut(s) 101, 291
HpyF3I CTNAG 1 cut(s) 200
Hsp92II CATG 1 cut(s) 299
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 3 cut(s) 26, 243, 291
Lsp1109I GCAGC 1 cut(s) 303
LweI GCATC 2 cut(s) 202, 272
MaeI CTAG 1 cut(s) 143
MaeIII GTNAC 2 cut(s) 149, 195
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MboII GAAGA 1 cut(s) 232
MluCI AATT 4 cut(s) 80, 157, 225, 283
MmeI TCCRAC 1 cut(s) 74
MnlI CCTC 2 cut(s) 143, 326
MseI TTAA 1 cut(s) 236
Mva1269I GAATGC 1 cut(s) 103
NdeII GATC 1 cut(s) 112
NlaIII CATG 1 cut(s) 299
PctI GAATGC 1 cut(s) 103
PfeI GAWTC 1 cut(s) 306
PkrI GCNGC 1 cut(s) 293
PstI CTGCAG 1 cut(s) 293
SaqAI TTAA 1 cut(s) 236
SatI GCNGC 1 cut(s) 292
Sau3AI GATC 1 cut(s) 112
SetI ASST 4 cut(s) 45, 124, 280, 318
SfaNI GCATC 2 cut(s) 202, 272
SfcI CTRYAG 1 cut(s) 289
SgeI CNNG 9 cut(s) 34, 53, 122, 131, 155, 242, 283, 290, 308
Sse9I AATT 4 cut(s) 80, 157, 225, 283
SspMI CTAG 1 cut(s) 143
TaqI TCGA 1 cut(s) 111
TasI AATT 4 cut(s) 80, 157, 225, 283
TfiI GAWTC 1 cut(s) 306
Tru1I TTAA 1 cut(s) 236
Tru9I TTAA 1 cut(s) 236
TseI GCWGC 1 cut(s) 291
TspGWI ACGGA 1 cut(s) 90
XapI RAATTY 1 cut(s) 80
XbaI TCTAGA 1 cut(s) 142
XspI CTAG 1 cut(s) 143
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.