Rh7CG094800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
Physical Location & Seq
Reverse (-)
7166356 .. 7169650
3295 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG094800.1

Sequence Viewer

Length: 309 bp
ATGGGCAACATCAAAGACGGAGACTTTGCTTTCAGCTGGAAACCAACCATTCTCAGATCCTCACCATTTAGATTATTACTTCAATTCTTTTTGGTGAGACATTTGATTTTGTTTTGGTTACTGAGAGAAATCAATGCTTTATTGCTTCCTGTGTTGATCTTCACACTACTTCTATTATGGGAATCAACCCTGAAACCGACAATTTCTATAGCCATGTTTCATTTTATGGGGGAAGACCTCCAATCCCTTGAGTATGAAAGAGCTTCAGATTTGGAGCAGCAACTTAACTCTGAAGCACATAAGATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

102

Amino Acids

11.99

Weight (kDa)

5.85

Isoelectric Point (pI)

58.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 51
AcuI CTGAAG 1 cut(s) 249
AgsI TTSAA 1 cut(s) 83
AluBI AGCT 2 cut(s) 36, 263
AluI AGCT 2 cut(s) 36, 263
Alw26I GTCTC 2 cut(s) 15, 91
AlwI GGATC 1 cut(s) 51
ApeKI GCWGC 1 cut(s) 277
ArsI GACNNNNNNTTYG 2 cut(s) 8, 40
AsuHPI GGTGA 2 cut(s) 54, 106
BbsI GAAGAC 1 cut(s) 240
BbvI GCAGC 1 cut(s) 289
BcoDI GTCTC 2 cut(s) 15, 91
BfaI CTAG 1 cut(s) 307
BfmI CTRYAG 1 cut(s) 207
BglII AGATCT 1 cut(s) 303
BisI GCNGC 1 cut(s) 278
BlsI GCNGC 1 cut(s) 279
BpiI GAAGAC 1 cut(s) 240
BpuEI CTTGAG 1 cut(s) 269
BseMII CTCAG 2 cut(s) 67, 113
BseXI GCAGC 1 cut(s) 289
BsmAI GTCTC 2 cut(s) 15, 91
Bsp143I GATC 3 cut(s) 56, 156, 303
BspCNI CTCAG 2 cut(s) 66, 114
BspPI GGATC 1 cut(s) 51
BssMI GATC 3 cut(s) 56, 156, 303
BstDEI CTNAG 2 cut(s) 53, 122
BstKTI GATC 3 cut(s) 59, 159, 306
BstMAI GTCTC 2 cut(s) 15, 91
BstMBI GATC 3 cut(s) 56, 156, 303
BstSFI CTRYAG 1 cut(s) 207
BstV1I GCAGC 1 cut(s) 289
BstV2I GAAGAC 1 cut(s) 240
BstX2I RGATCY 2 cut(s) 56, 303
BstYI RGATCY 2 cut(s) 56, 303
CviAII CATG 1 cut(s) 214
CviJI RGCY 3 cut(s) 36, 212, 263
CviKI_1 RGCY 3 cut(s) 36, 212, 263
DdeI CTNAG 2 cut(s) 53, 122
DpnI GATC 3 cut(s) 58, 158, 305
DpnII GATC 3 cut(s) 56, 156, 303
Eco57I CTGAAG 1 cut(s) 249
FaeI CATG 1 cut(s) 217
FaiI YATR 6 cut(s) 178, 209, 215, 227, 255, 300
FatI CATG 1 cut(s) 213
Fnu4HI GCNGC 1 cut(s) 278
Fsp4HI GCNGC 1 cut(s) 278
FspBI CTAG 1 cut(s) 307
GluI GCNGC 1 cut(s) 278
Hin1II CATG 1 cut(s) 217
HinfI GANTC 1 cut(s) 182
HphI GGTGA 2 cut(s) 54, 106
Hpy188I TCNGA 3 cut(s) 56, 268, 292
HpyF3I CTNAG 2 cut(s) 53, 122
Hsp92II CATG 1 cut(s) 217
Kzo9I GATC 3 cut(s) 56, 156, 303
LmnI GCTCC 1 cut(s) 274
LpnPI CCDG 3 cut(s) 22, 162, 203
Lsp1109I GCAGC 1 cut(s) 289
MaeI CTAG 1 cut(s) 307
MaeIII GTNAC 1 cut(s) 117
MalI GATC 3 cut(s) 58, 158, 305
MboI GATC 3 cut(s) 56, 156, 303
MboII GAAGA 2 cut(s) 151, 245
MflI RGATCY 2 cut(s) 56, 303
MluCI AATT 2 cut(s) 83, 201
MnlI CCTC 2 cut(s) 70, 248
MseI TTAA 1 cut(s) 285
MspA1I CMGCKG 1 cut(s) 36
NdeII GATC 3 cut(s) 56, 156, 303
NlaIII CATG 1 cut(s) 217
PfeI GAWTC 1 cut(s) 182
PkrI GCNGC 1 cut(s) 279
PsuI RGATCY 2 cut(s) 56, 303
PvuII CAGCTG 1 cut(s) 36
SaqAI TTAA 1 cut(s) 285
SatI GCNGC 1 cut(s) 278
Sau3AI GATC 3 cut(s) 56, 156, 303
SetI ASST 3 cut(s) 38, 240, 265
SfcI CTRYAG 1 cut(s) 207
SgeI CNNG 5 cut(s) 49, 161, 202, 226, 260
SmlI CTYRAG 1 cut(s) 248
SmoI CTYRAG 1 cut(s) 248
Sse9I AATT 2 cut(s) 83, 201
SspMI CTAG 1 cut(s) 307
TasI AATT 2 cut(s) 83, 201
TfiI GAWTC 1 cut(s) 182
Tru1I TTAA 1 cut(s) 285
Tru9I TTAA 1 cut(s) 285
TseI GCWGC 1 cut(s) 277
TspDTI ATGAA 2 cut(s) 209, 270
TspGWI ACGGA 1 cut(s) 33
XspI CTAG 1 cut(s) 307
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.