Rorug04G0172900

zinc finger CCCH domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
30403869 .. 30404096
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0172900.1

Sequence Viewer

Length: 228 bp
ATGAGTAAGGGCTATGTGGGAGACCTCACTTGTTTGTTATGCAACCATCTGTTGGAAGACACTACTCATATCTTTTGTAAGTGCACTACAGCCTCTACTCTTTTATCTCAATCTCCATTCCACCTCCAAAGTTCTTTGCTTCCTCAAATCAATTTCAAAGAATGGATGCTGGAACAAGCTTTGAATCTTAGAATGGAGGTTTTTGAAAAGCTCTTGATGCTTATATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.63

Weight (kDa)

5.8

Isoelectric Point (pI)

61.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 52
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 3 cut(s) 157, 184, 206
AluBI AGCT 2 cut(s) 179, 211
AluI AGCT 2 cut(s) 179, 211
Alw21I GWGCWC 1 cut(s) 86
Alw26I GTCTC 1 cut(s) 15
Alw44I GTGCAC 1 cut(s) 82
ApaLI GTGCAC 1 cut(s) 82
BaeGI GKGCMC 1 cut(s) 86
BbsI GAAGAC 1 cut(s) 63
Bbv12I GWGCWC 1 cut(s) 86
BccI CCATC 1 cut(s) 54
BcoDI GTCTC 1 cut(s) 15
BfmI CTRYAG 1 cut(s) 87
BmsI GCATC 2 cut(s) 156, 207
BpiI GAAGAC 1 cut(s) 63
BsaI GGTCTC 1 cut(s) 15
Bsc4I CCNNNNNNNGG 1 cut(s) 52
BseGI GGATG 1 cut(s) 171
BseLI CCNNNNNNNGG 1 cut(s) 52
BseSI GKGCMC 1 cut(s) 86
BsiHKAI GWGCWC 1 cut(s) 86
BslI CCNNNNNNNGG 1 cut(s) 52
BsmAI GTCTC 1 cut(s) 15
Bso31I GGTCTC 1 cut(s) 15
Bsp1286I GDGCHC 1 cut(s) 86
BspTNI GGTCTC 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 188
BstF5I GGATG 1 cut(s) 171
BstMAI GTCTC 1 cut(s) 15
BstMWI GCNNNNNNNGC 1 cut(s) 217
BstSFI CTRYAG 1 cut(s) 87
BstSLI GKGCMC 1 cut(s) 86
BstV2I GAAGAC 1 cut(s) 63
BtsCI GGATG 1 cut(s) 171
CviJI RGCY 4 cut(s) 12, 92, 179, 211
CviKI_1 RGCY 4 cut(s) 12, 92, 179, 211
DdeI CTNAG 1 cut(s) 188
Eco31I GGTCTC 1 cut(s) 15
FaiI YATR 5 cut(s) 15, 40, 69, 224, 226
FokI GGATG 1 cut(s) 178
HindIII AAGCTT 1 cut(s) 177
HinfI GANTC 1 cut(s) 184
Hpy166II GTNNAC 1 cut(s) 84
Hpy188III TCNNGA 1 cut(s) 214
Hpy8I GTNNAC 1 cut(s) 84
HpyCH4V TGCA 2 cut(s) 42, 84
HpyF10VI GCNNNNNNNGC 1 cut(s) 217
HpyF3I CTNAG 1 cut(s) 188
LpnPI CCDG 1 cut(s) 155
LweI GCATC 2 cut(s) 156, 207
MboII GAAGA 1 cut(s) 68
MhlI GDGCHC 1 cut(s) 86
MluCI AATT 1 cut(s) 151
MmeI TCCRAC 1 cut(s) 33
MnlI CCTC 5 cut(s) 35, 103, 134, 153, 190
MwoI GCNNNNNNNGC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 184
PflMI CCANNNNNTGG 1 cut(s) 52
SduI GDGCHC 1 cut(s) 86
SetI ASST 5 cut(s) 27, 126, 181, 201, 213
SfaNI GCATC 2 cut(s) 156, 207
SfcI CTRYAG 1 cut(s) 87
SgeI CNNG 3 cut(s) 42, 182, 188
Sse9I AATT 1 cut(s) 151
TasI AATT 1 cut(s) 151
TfiI GAWTC 1 cut(s) 184
Van91I CCANNNNNTGG 1 cut(s) 52
VneI GTGCAC 1 cut(s) 82
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.