Rorug04G0179300

BEST Arabidopsis thaliana protein match is

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Forward (+)
31457791 .. 31458239
449 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0179300.1

Sequence Viewer

Length: 285 bp
ATGGTGGTTGTCCATAATGAGCCATGTGCATCCCAAAACATGGATGATCAACACTGTAATAGAATCAAACCTCGTGATCTATATGATCTTGTGGTGGTTGTCCATGATGAGCCATGTGCACCCCAAAACATGGATGATGTAAGTTTAAATGTGTATGAGGAGGTCATGCAAACTGATATAGATGGAATTACACTTAATCAAATGGTATCTCAGTGGAGGGAGATCCTTGATGAAGAAGTTGAGCACAGTATTGTGGATGTTGCCGACAGTAACTCAGATGGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

94

Amino Acids

10.7

Weight (kDa)

4.05

Isoelectric Point (pI)

27.88

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013202)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 40, 130
AclWI GGATC 1 cut(s) 217
AfiI CCNNNNNNNGG 2 cut(s) 40, 130
Alw21I GWGCWC 2 cut(s) 121, 246
Alw44I GTGCAC 1 cut(s) 117
AlwI GGATC 1 cut(s) 217
ApaLI GTGCAC 1 cut(s) 117
BaeGI GKGCMC 1 cut(s) 121
BauI CACGAG 1 cut(s) 72
Bbv12I GWGCWC 2 cut(s) 121, 246
BccI CCATC 2 cut(s) 176, 272
BclI TGATCA 1 cut(s) 46
BmsI GCATC 1 cut(s) 38
Bsc4I CCNNNNNNNGG 2 cut(s) 40, 130
BseGI GGATG 4 cut(s) 29, 49, 139, 262
BseLI CCNNNNNNNGG 2 cut(s) 40, 130
BseMII CTCAG 1 cut(s) 224
BseRI GAGGAG 1 cut(s) 173
BseSI GKGCMC 1 cut(s) 121
BsiHKAI GWGCWC 2 cut(s) 121, 246
BslI CCNNNNNNNGG 2 cut(s) 40, 130
Bsp1286I GDGCHC 2 cut(s) 121, 246
Bsp143I GATC 4 cut(s) 46, 76, 85, 222
BspCNI CTCAG 1 cut(s) 223
BspPI GGATC 1 cut(s) 217
BssMI GATC 4 cut(s) 46, 76, 85, 222
BssSI CACGAG 1 cut(s) 72
Bst2BI CACGAG 1 cut(s) 72
Bst4CI ACNGT 3 cut(s) 56, 248, 269
BstDEI CTNAG 2 cut(s) 210, 274
BstF5I GGATG 4 cut(s) 29, 49, 139, 262
BstKTI GATC 4 cut(s) 49, 79, 88, 225
BstMBI GATC 4 cut(s) 46, 76, 85, 222
BstSLI GKGCMC 1 cut(s) 121
BstX2I RGATCY 1 cut(s) 222
BstYI RGATCY 1 cut(s) 222
BtsCI GGATG 4 cut(s) 29, 49, 139, 262
BtsIMutI CAGTG 2 cut(s) 52, 218
CviAII CATG 6 cut(s) 24, 40, 104, 114, 130, 166
CviJI RGCY 2 cut(s) 22, 112
CviKI_1 RGCY 2 cut(s) 22, 112
DdeI CTNAG 2 cut(s) 210, 274
DpnI GATC 4 cut(s) 48, 78, 87, 224
DpnII GATC 4 cut(s) 46, 76, 85, 222
DraI TTTAAA 1 cut(s) 147
FaeI CATG 6 cut(s) 27, 43, 107, 117, 133, 169
FatI CATG 6 cut(s) 23, 39, 103, 113, 129, 165
FbaI TGATCA 1 cut(s) 46
FokI GGATG 4 cut(s) 16, 56, 146, 269
Hin1II CATG 6 cut(s) 27, 43, 107, 117, 133, 169
HinfI GANTC 1 cut(s) 63
Hpy166II GTNNAC 1 cut(s) 119
Hpy188I TCNGA 1 cut(s) 277
Hpy188III TCNNGA 1 cut(s) 74
Hpy8I GTNNAC 1 cut(s) 119
HpyCH4III ACNGT 3 cut(s) 56, 248, 269
HpyCH4V TGCA 3 cut(s) 29, 119, 169
HpyF3I CTNAG 2 cut(s) 210, 274
Hsp92II CATG 6 cut(s) 27, 43, 107, 117, 133, 169
Ksp22I TGATCA 1 cut(s) 46
Kzo9I GATC 4 cut(s) 46, 76, 85, 222
LweI GCATC 1 cut(s) 38
MaeIII GTNAC 1 cut(s) 269
MalI GATC 4 cut(s) 48, 78, 87, 224
MboI GATC 4 cut(s) 46, 76, 85, 222
MboII GAAGA 1 cut(s) 245
MflI RGATCY 1 cut(s) 222
MhlI GDGCHC 2 cut(s) 121, 246
MluCI AATT 1 cut(s) 186
MnlI CCTC 4 cut(s) 81, 151, 154, 210
MseI TTAA 2 cut(s) 146, 195
NdeII GATC 4 cut(s) 46, 76, 85, 222
NlaIII CATG 6 cut(s) 27, 43, 107, 117, 133, 169
PfeI GAWTC 1 cut(s) 63
PflMI CCANNNNNTGG 2 cut(s) 40, 130
PsuI RGATCY 1 cut(s) 222
SaqAI TTAA 2 cut(s) 146, 195
Sau3AI GATC 4 cut(s) 46, 76, 85, 222
SduI GDGCHC 2 cut(s) 121, 246
SetI ASST 2 cut(s) 73, 165
SfaNI GCATC 1 cut(s) 38
Sse9I AATT 1 cut(s) 186
TaaI ACNGT 3 cut(s) 56, 248, 269
TasI AATT 1 cut(s) 186
TfiI GAWTC 1 cut(s) 63
Tru1I TTAA 2 cut(s) 146, 195
Tru9I TTAA 2 cut(s) 146, 195
TscAI CASTG 2 cut(s) 59, 218
TspDTI ATGAA 1 cut(s) 246
TspRI CASTG 2 cut(s) 59, 218
Van91I CCANNNNNTGG 2 cut(s) 40, 130
VneI GTGCAC 1 cut(s) 117
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.