Rorug05G0248300

Arginine and glutamate-rich 1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0007060
Physical Location & Seq
Forward (+)
27229612 .. 27229971
360 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0248300.1

Sequence Viewer

Length: 285 bp
ATGGCTAGCATTGCTAAAGATGCATGTAATATTAAGTTTGTAAGTATAATTAAAGTGAAGCCTAGAGAGGCTCTGTTTTTTAGAAATGCTGATGGTAATCCAGTACTAGCAGCTTCTACCTCGCTTCCCTCTGTGGACATTCTAGTTGCAGAGCCTCTCTCCCTCCGAGCTGGTTTACATGCCGCCTTGATTCATGGCTTTCAGTCTTTGGATATTAAAGGTGATTCTAAAGTCCTTGTAGATGCATTGACTGGCCAAATTTCGATCTCCTCCCTGGCGTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ARGLU

Protein Analysis

94

Amino Acids

9.83

Weight (kDa)

7.82

Isoelectric Point (pI)

34.27

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RVT_3 PF13456 27 - 87 5.1e-09 Reverse transcriptase-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 183
AcoI YGGCCR 1 cut(s) 253
AcsI RAATTY 1 cut(s) 258
AfaI GTAC 1 cut(s) 105
AjnI CCWGG 1 cut(s) 273
AluBI AGCT 2 cut(s) 113, 170
AluI AGCT 2 cut(s) 113, 170
AoxI GGCC 1 cut(s) 253
ApeKI GCWGC 1 cut(s) 110
ApoI RAATTY 1 cut(s) 258
AsuHPI GGTGA 1 cut(s) 233
AsuNHI GCTAGC 1 cut(s) 5
BalI TGGCCA 1 cut(s) 255
BbvI GCAGC 1 cut(s) 122
BccI CCATC 1 cut(s) 86
BciT130I CCWGG 1 cut(s) 275
BfaI CTAG 4 cut(s) 6, 63, 107, 143
BisI GCNGC 2 cut(s) 111, 183
BlsI GCNGC 2 cut(s) 112, 184
BmcAI AGTACT 1 cut(s) 105
Bme1390I CCNGG 1 cut(s) 275
BmrFI CCNGG 1 cut(s) 275
BmsI GCATC 2 cut(s) 10, 232
BmtI GCTAGC 1 cut(s) 9
BplI GAGNNNNNCTC 2 cut(s) 143, 175
BsaBI GATNNNNATC 1 cut(s) 96
BsaJI CCNNGG 1 cut(s) 273
Bse1I ACTGG 2 cut(s) 101, 256
Bse3DI GCAATG 1 cut(s) 9
Bse8I GATNNNNATC 1 cut(s) 96
BseBI CCWGG 1 cut(s) 275
BseDI CCNNGG 1 cut(s) 273
BseJI GATNNNNATC 1 cut(s) 96
BseMI GCAATG 1 cut(s) 9
BseNI ACTGG 2 cut(s) 101, 256
BseRI GAGGAG 1 cut(s) 259
BseXI GCAGC 1 cut(s) 122
BshFI GGCC 1 cut(s) 255
BsnI GGCC 1 cut(s) 255
Bsp143I GATC 1 cut(s) 264
BspACI CCGC 1 cut(s) 183
BspANI GGCC 1 cut(s) 255
BspOI GCTAGC 1 cut(s) 9
BsrDI GCAATG 1 cut(s) 9
BsrI ACTGG 2 cut(s) 101, 256
BssECI CCNNGG 1 cut(s) 273
BssMI GATC 1 cut(s) 264
Bst2UI CCWGG 1 cut(s) 275
BstC8I GCNNGC 1 cut(s) 7
BstKTI GATC 1 cut(s) 267
BstMBI GATC 1 cut(s) 264
BstMWI GCNNNNNNNGC 2 cut(s) 11, 20
BstNI CCWGG 1 cut(s) 275
BstNSI RCATGY 2 cut(s) 27, 182
BstSCI CCNGG 1 cut(s) 273
BstV1I GCAGC 1 cut(s) 122
BsuRI GGCC 1 cut(s) 255
Cac8I GCNNGC 1 cut(s) 7
Csp6I GTAC 1 cut(s) 104
CviAII CATG 3 cut(s) 24, 179, 194
CviJI RGCY 8 cut(s) 5, 61, 71, 113, 154, 170, 198, 255
CviKI_1 RGCY 8 cut(s) 5, 61, 71, 113, 154, 170, 198, 255
CviQI GTAC 1 cut(s) 104
DpnI GATC 1 cut(s) 266
DpnII GATC 1 cut(s) 264
EaeI YGGCCR 1 cut(s) 253
EcoRII CCWGG 1 cut(s) 273
EcoT22I ATGCAT 2 cut(s) 25, 247
FaeI CATG 3 cut(s) 27, 182, 197
FaiI YATR 4 cut(s) 25, 47, 180, 195
FatI CATG 3 cut(s) 23, 178, 193
Fnu4HI GCNGC 2 cut(s) 111, 183
Fsp4HI GCNGC 2 cut(s) 111, 183
FspBI CTAG 4 cut(s) 6, 63, 107, 143
GluI GCNGC 2 cut(s) 111, 183
HaeIII GGCC 1 cut(s) 255
Hin1II CATG 3 cut(s) 27, 182, 197
HinfI GANTC 2 cut(s) 190, 224
HphI GGTGA 1 cut(s) 233
Hpy166II GTNNAC 2 cut(s) 136, 176
Hpy188I TCNGA 1 cut(s) 167
Hpy8I GTNNAC 2 cut(s) 136, 176
HpyCH4V TGCA 3 cut(s) 23, 149, 245
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 20
Hsp92II CATG 3 cut(s) 27, 182, 197
Kzo9I GATC 1 cut(s) 264
LpnPI CCDG 4 cut(s) 114, 156, 237, 260
Lsp1109I GCAGC 1 cut(s) 122
LweI GCATC 2 cut(s) 10, 232
MaeI CTAG 4 cut(s) 6, 63, 107, 143
MalI GATC 1 cut(s) 266
MboI GATC 1 cut(s) 264
MlsI TGGCCA 1 cut(s) 255
MluCI AATT 2 cut(s) 48, 258
MluNI TGGCCA 1 cut(s) 255
MnlI CCTC 6 cut(s) 61, 130, 139, 165, 173, 280
Mox20I TGGCCA 1 cut(s) 255
Mph1103I ATGCAT 2 cut(s) 25, 247
MscI TGGCCA 1 cut(s) 255
MseI TTAA 4 cut(s) 33, 51, 216, 283
Msp20I TGGCCA 1 cut(s) 255
MspR9I CCNGG 1 cut(s) 275
MvaI CCWGG 1 cut(s) 275
MwoI GCNNNNNNNGC 2 cut(s) 11, 20
NdeII GATC 1 cut(s) 264
NheI GCTAGC 1 cut(s) 5
NlaIII CATG 3 cut(s) 27, 182, 197
NsiI ATGCAT 2 cut(s) 25, 247
NspI RCATGY 2 cut(s) 27, 182
PfeI GAWTC 2 cut(s) 190, 224
PkrI GCNGC 2 cut(s) 112, 184
Psp6I CCWGG 1 cut(s) 273
PspGI CCWGG 1 cut(s) 273
RsaI GTAC 1 cut(s) 105
RsaNI GTAC 1 cut(s) 104
SaqAI TTAA 4 cut(s) 33, 51, 216, 283
SatI GCNGC 2 cut(s) 111, 183
Sau3AI GATC 1 cut(s) 264
ScaI AGTACT 1 cut(s) 105
ScrFI CCNGG 1 cut(s) 275
SetI ASST 4 cut(s) 115, 122, 172, 223
SfaNI GCATC 2 cut(s) 10, 232
Sse9I AATT 2 cut(s) 48, 258
SsiI CCGC 1 cut(s) 183
SspI AATATT 1 cut(s) 31
SspMI CTAG 4 cut(s) 6, 63, 107, 143
StyD4I CCNGG 1 cut(s) 273
TaqI TCGA 1 cut(s) 263
TasI AATT 2 cut(s) 48, 258
TatI WGTACW 1 cut(s) 103
TauI GCSGC 1 cut(s) 185
TfiI GAWTC 2 cut(s) 190, 224
Tru1I TTAA 4 cut(s) 33, 51, 216, 283
Tru9I TTAA 4 cut(s) 33, 51, 216, 283
TseI GCWGC 1 cut(s) 110
TspDTI ATGAA 1 cut(s) 182
XapI RAATTY 1 cut(s) 258
XceI RCATGY 2 cut(s) 27, 182
XspI CTAG 4 cut(s) 6, 63, 107, 143
ZrmI AGTACT 1 cut(s) 105
Zsp2I ATGCAT 2 cut(s) 25, 247
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.