Rorug06G0270300

PHD-finger

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000006
Physical Location & Seq
Forward (+)
41729805 .. 41731426
1622 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug06G0270300.1

Sequence Viewer

Length: 435 bp
ATGGATCCTCCTCATGGATGCAGGTCATGGAGGCCGTGCTTACTTCACCATCCCCACCACCATCTTCACCATCACCATCATCACCACCCCTTATTCCTCAACCCCCACCACCACCACCATCACCACCACCACTTCAACTGCCACCACCACCATGTTCGCCCCAATTTCACATCTTTTGCTCAAAACCCAGAACAAGCTACTCCCGTTCCTTTCCCAACCTATTCAAAGTCGGAAACTTCTGGGATCAAAGGCGCGTACGATTACAATCCTACCCCCCTGGTATTGCAGGAGCAGAATCATGATGATGTTGCGTTAGAAGAGGAAGAGGATGATGACCCAATTTTCGTCTTAACTGATGAATGGAAAGAATTTTTCGCGAAATCTGAAGCTAAGAGGAAACTAGAGAGGAAGCAAGCTAAAAAGGGAAAGAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

144

Amino Acids

17.13

Weight (kDa)

6.83

Isoelectric Point (pI)

40.4

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 12
AccII CGCG 2 cut(s) 254, 377
AclWI GGATC 2 cut(s) 12, 251
AcsI RAATTY 1 cut(s) 368
AcuI CTGAAG 1 cut(s) 405
AfaI GTAC 1 cut(s) 257
AfiI CCNNNNNNNGG 1 cut(s) 14
AgsI TTSAA 2 cut(s) 136, 225
AjnI CCWGG 1 cut(s) 276
AluBI AGCT 3 cut(s) 197, 389, 416
AluI AGCT 3 cut(s) 197, 389, 416
AlwI GGATC 2 cut(s) 12, 251
AoxI GGCC 1 cut(s) 32
ApoI RAATTY 1 cut(s) 368
ArsI GACNNNNNNTTYG 2 cut(s) 326, 358
AspLEI GCGC 1 cut(s) 254
AsuHPI GGTGA 5 cut(s) 38, 59, 65, 74, 113
BamHI GGATCC 1 cut(s) 4
BccI CCATC 5 cut(s) 57, 69, 78, 84, 126
BceAI ACGGC 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 278
BfaI CTAG 1 cut(s) 401
BfuAI ACCTGC 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 278
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 278
BmsI GCATC 1 cut(s) 8
BsaBI GATNNNNATC 1 cut(s) 264
BsaJI CCNNGG 1 cut(s) 276
Bsc4I CCNNNNNNNGG 1 cut(s) 14
Bse8I GATNNNNATC 1 cut(s) 264
BseBI CCWGG 1 cut(s) 278
BseDI CCNNGG 1 cut(s) 276
BseGI GGATG 3 cut(s) 23, 49, 334
BseJI GATNNNNATC 1 cut(s) 264
BseLI CCNNNNNNNGG 1 cut(s) 14
Bsh1236I CGCG 2 cut(s) 254, 377
BshFI GGCC 1 cut(s) 34
BsiWI CGTACG 1 cut(s) 255
BslI CCNNNNNNNGG 1 cut(s) 14
BsnI GGCC 1 cut(s) 34
Bsp143I GATC 2 cut(s) 4, 243
Bsp68I TCGCGA 1 cut(s) 377
BspANI GGCC 1 cut(s) 34
BspFNI CGCG 2 cut(s) 254, 377
BspHI TCATGA 1 cut(s) 298
BspLI GGNNCC 1 cut(s) 6
BspMI ACCTGC 1 cut(s) 12
BspPI GGATC 2 cut(s) 12, 251
BssECI CCNNGG 1 cut(s) 276
BssMI GATC 2 cut(s) 4, 243
Bst2UI CCWGG 1 cut(s) 278
Bst6I CTCTTC 2 cut(s) 312, 318
BstC8I GCNNGC 1 cut(s) 414
BstDEI CTNAG 1 cut(s) 390
BstF5I GGATG 3 cut(s) 23, 49, 334
BstFNI CGCG 2 cut(s) 254, 377
BstHHI GCGC 1 cut(s) 254
BstKTI GATC 2 cut(s) 7, 246
BstMBI GATC 2 cut(s) 4, 243
BstNI CCWGG 1 cut(s) 278
BstSCI CCNGG 1 cut(s) 276
BstUI CGCG 2 cut(s) 254, 377
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 1 cut(s) 34
BtsCI GGATG 3 cut(s) 23, 49, 334
BtuMI TCGCGA 1 cut(s) 377
BveI ACCTGC 1 cut(s) 12
Cac8I GCNNGC 1 cut(s) 414
CciI TCATGA 1 cut(s) 298
CfoI GCGC 1 cut(s) 254
Csp6I GTAC 1 cut(s) 256
CviAII CATG 4 cut(s) 14, 27, 152, 299
CviJI RGCY 4 cut(s) 34, 197, 389, 416
CviKI_1 RGCY 4 cut(s) 34, 197, 389, 416
CviQI GTAC 1 cut(s) 256
DdeI CTNAG 1 cut(s) 390
DpnI GATC 2 cut(s) 6, 245
DpnII GATC 2 cut(s) 4, 243
Eam1104I CTCTTC 2 cut(s) 312, 318
EarI CTCTTC 2 cut(s) 312, 318
Eco57I CTGAAG 1 cut(s) 405
EcoRII CCWGG 1 cut(s) 276
FaeI CATG 4 cut(s) 17, 30, 155, 302
FaiI YATR 4 cut(s) 15, 28, 153, 300
FatI CATG 4 cut(s) 13, 26, 151, 298
FokI GGATG 3 cut(s) 30, 36, 341
FspBI CTAG 1 cut(s) 401
GlaI GCGC 1 cut(s) 253
HaeIII GGCC 1 cut(s) 34
HhaI GCGC 1 cut(s) 254
Hin1II CATG 4 cut(s) 17, 30, 155, 302
Hin6I GCGC 1 cut(s) 252
HinP1I GCGC 1 cut(s) 252
HinfI GANTC 1 cut(s) 295
HphI GGTGA 5 cut(s) 38, 59, 65, 74, 113
Hpy188I TCNGA 2 cut(s) 232, 385
Hpy188III TCNNGA 2 cut(s) 299, 376
HpyCH4V TGCA 2 cut(s) 21, 286
HpyF3I CTNAG 1 cut(s) 390
Hsp92II CATG 4 cut(s) 17, 30, 155, 302
HspAI GCGC 1 cut(s) 252
Kzo9I GATC 2 cut(s) 4, 243
LmnI GCTCC 1 cut(s) 289
LpnPI CCDG 6 cut(s) 7, 201, 225, 263, 272, 290
LweI GCATC 1 cut(s) 8
MaeI CTAG 1 cut(s) 401
MalI GATC 2 cut(s) 6, 245
MboI GATC 2 cut(s) 4, 243
MboII GAAGA 3 cut(s) 56, 329, 335
MflI RGATCY 1 cut(s) 4
MluCI AATT 3 cut(s) 163, 339, 368
MmeI TCCRAC 1 cut(s) 210
MnlI CCTC 8 cut(s) 18, 21, 24, 107, 313, 319, 387, 399
MseI TTAA 1 cut(s) 350
MslI CAYNNNNRTG 2 cut(s) 150, 303
MspR9I CCNGG 1 cut(s) 278
MvaI CCWGG 1 cut(s) 278
MvnI CGCG 2 cut(s) 254, 377
NdeII GATC 2 cut(s) 4, 243
NlaIII CATG 4 cut(s) 17, 30, 155, 302
NlaIV GGNNCC 1 cut(s) 6
NruI TCGCGA 1 cut(s) 377
PagI TCATGA 1 cut(s) 298
PfeI GAWTC 1 cut(s) 295
Pfl23II CGTACG 1 cut(s) 255
Psp6I CCWGG 1 cut(s) 276
PspGI CCWGG 1 cut(s) 276
PspLI CGTACG 1 cut(s) 255
PspN4I GGNNCC 1 cut(s) 6
PsuI RGATCY 1 cut(s) 4
RruI TCGCGA 1 cut(s) 377
RsaI GTAC 1 cut(s) 257
RsaNI GTAC 1 cut(s) 256
RseI CAYNNNNRTG 2 cut(s) 150, 303
SaqAI TTAA 1 cut(s) 350
Sau3AI GATC 2 cut(s) 4, 243
ScrFI CCNGG 1 cut(s) 278
SetI ASST 5 cut(s) 26, 199, 221, 391, 418
SfaNI GCATC 1 cut(s) 8
SmiMI CAYNNNNRTG 2 cut(s) 150, 303
Sse9I AATT 3 cut(s) 163, 339, 368
SspMI CTAG 1 cut(s) 401
StyD4I CCNGG 1 cut(s) 276
TasI AATT 3 cut(s) 163, 339, 368
TfiI GAWTC 1 cut(s) 295
Tru1I TTAA 1 cut(s) 350
Tru9I TTAA 1 cut(s) 350
TspDTI ATGAA 1 cut(s) 372
XapI RAATTY 1 cut(s) 368
XspI CTAG 1 cut(s) 401
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.