Rorug07G0198200

transcription factor

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Forward (+)
17142334 .. 17145155
2822 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0198200.1

Sequence Viewer

Length: 213 bp
ATGCAACAAGCCTGCATGGATGGATCGTATGAACCTTCAATATCTGATATTGGTTTGGTGTCCCAAAGTACGATAAATGGAAGTGATGGTAATGAAATGCAATATAAGGGAGTTTGGTATGATAAGTTGTCTACAGAATATCTTAAAAGGCAGGAGTTTAAGAAAAATGGTCCTGGTCGGCCTCGTGGCTCAAAGAATAAACCTAAGAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

70

Amino Acids

7.89

Weight (kDa)

9.34

Isoelectric Point (pI)

40.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 131
AclWI GGATC 1 cut(s) 31
AfaI GTAC 1 cut(s) 70
AgsI TTSAA 1 cut(s) 39
AjnI CCWGG 1 cut(s) 172
AlwI GGATC 1 cut(s) 31
AoxI GGCC 1 cut(s) 179
AspS9I GGNCC 1 cut(s) 170
AvaII GGWCC 1 cut(s) 170
BauI CACGAG 1 cut(s) 183
BccI CCATC 2 cut(s) 14, 80
BciT130I CCWGG 1 cut(s) 174
BfmI CTRYAG 1 cut(s) 132
Bme1390I CCNGG 1 cut(s) 174
Bme18I GGWCC 1 cut(s) 170
BmgT120I GGNCC 1 cut(s) 170
BmrFI CCNGG 1 cut(s) 174
BseBI CCWGG 1 cut(s) 174
BseGI GGATG 1 cut(s) 25
BshFI GGCC 1 cut(s) 181
BslFI GGGAC 1 cut(s) 46
BsmFI GGGAC 1 cut(s) 46
BsnI GGCC 1 cut(s) 181
Bsp143I GATC 1 cut(s) 23
BspANI GGCC 1 cut(s) 181
BspPI GGATC 1 cut(s) 31
BssMI GATC 1 cut(s) 23
BssSI CACGAG 1 cut(s) 183
Bst2BI CACGAG 1 cut(s) 183
Bst2UI CCWGG 1 cut(s) 174
BstC8I GCNNGC 1 cut(s) 13
BstDEI CTNAG 1 cut(s) 204
BstF5I GGATG 1 cut(s) 25
BstKTI GATC 1 cut(s) 26
BstMBI GATC 1 cut(s) 23
BstNI CCWGG 1 cut(s) 174
BstSCI CCNGG 1 cut(s) 172
BstSFI CTRYAG 1 cut(s) 132
BsuRI GGCC 1 cut(s) 181
BtsCI GGATG 1 cut(s) 25
Cac8I GCNNGC 1 cut(s) 13
Cfr13I GGNCC 1 cut(s) 170
Csp6I GTAC 1 cut(s) 69
CviAII CATG 1 cut(s) 16
CviJI RGCY 3 cut(s) 11, 181, 189
CviKI_1 RGCY 3 cut(s) 11, 181, 189
CviQI GTAC 1 cut(s) 69
DdeI CTNAG 1 cut(s) 204
DpnI GATC 1 cut(s) 25
DpnII GATC 1 cut(s) 23
Eco47I GGWCC 1 cut(s) 170
EcoRII CCWGG 1 cut(s) 172
FaeI CATG 1 cut(s) 19
FaiI YATR 4 cut(s) 17, 30, 105, 120
FaqI GGGAC 1 cut(s) 46
FatI CATG 1 cut(s) 15
FblI GTMKAC 1 cut(s) 131
FokI GGATG 1 cut(s) 32
HaeIII GGCC 1 cut(s) 181
Hin1II CATG 1 cut(s) 19
Hpy166II GTNNAC 1 cut(s) 132
Hpy188I TCNGA 1 cut(s) 46
Hpy8I GTNNAC 1 cut(s) 132
HpyAV CCTTC 1 cut(s) 45
HpyCH4V TGCA 3 cut(s) 4, 15, 100
HpyF3I CTNAG 1 cut(s) 204
Hsp92II CATG 1 cut(s) 19
Kzo9I GATC 1 cut(s) 23
LpnPI CCDG 4 cut(s) 25, 137, 159, 186
MalI GATC 1 cut(s) 25
MboI GATC 1 cut(s) 23
MnlI CCTC 1 cut(s) 192
MseI TTAA 2 cut(s) 144, 159
MspR9I CCNGG 1 cut(s) 174
MvaI CCWGG 1 cut(s) 174
NdeII GATC 1 cut(s) 23
NlaIII CATG 1 cut(s) 19
Psp6I CCWGG 1 cut(s) 172
PspGI CCWGG 1 cut(s) 172
PspPI GGNCC 1 cut(s) 170
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
SaqAI TTAA 2 cut(s) 144, 159
Sau3AI GATC 1 cut(s) 23
Sau96I GGNCC 1 cut(s) 170
ScrFI CCNGG 1 cut(s) 174
SetI ASST 2 cut(s) 37, 205
SfcI CTRYAG 1 cut(s) 132
SgeI CNNG 8 cut(s) 20, 24, 28, 164, 185, 186, 195, 197
SinI GGWCC 1 cut(s) 170
StyD4I CCNGG 1 cut(s) 172
Tru1I TTAA 2 cut(s) 144, 159
Tru9I TTAA 2 cut(s) 144, 159
TspDTI ATGAA 2 cut(s) 45, 108
VpaK11BI GGWCC 1 cut(s) 170
XmiI GTMKAC 1 cut(s) 131
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.