Rorug07G0249900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
OG0006230
Physical Location & Seq
Reverse (-)
23158086 .. 23158313
228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0249900.1

Sequence Viewer

Length: 228 bp
ATGGGTTTTCGATTGCCTCGAATTGCTAGCACAAAGACATCAGATATCCCAAAAAGCTACTTTGCAGTCTATGTTGGAGAGAGCCAGAAGAAACGATTTGTGGTTCCAATATCATATTTGAACCAACCTTTGTTTCAGGATTTGCTGAGTCAAGCTGAAGAAGAATTTGGATACCATCATCCAACGGGTGGTATGATACATGGCTGGGAAATTTGGATACATATCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.69

Weight (kDa)

6.9

Isoelectric Point (pI)

47.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 9 - 62 7.5e-18 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 188
AcsI RAATTY 2 cut(s) 164, 210
AcuI CTGAAG 1 cut(s) 177
AfiI CCNNNNNNNGG 1 cut(s) 188
AgsI TTSAA 1 cut(s) 121
AjuI GAANNNNNNNTTGG 4 cut(s) 117, 149, 150, 182
AluBI AGCT 2 cut(s) 57, 155
AluI AGCT 2 cut(s) 57, 155
ApoI RAATTY 2 cut(s) 164, 210
AsuNHI GCTAGC 1 cut(s) 26
BccI CCATC 1 cut(s) 183
BciVI GTATCC 2 cut(s) 164, 210
BfaI CTAG 2 cut(s) 27, 226
BfuI GTATCC 2 cut(s) 164, 210
BmiI GGNNCC 1 cut(s) 105
BmtI GCTAGC 1 cut(s) 30
BsaBI GATNNNNATC 1 cut(s) 221
Bsc4I CCNNNNNNNGG 1 cut(s) 188
Bse8I GATNNNNATC 1 cut(s) 221
BseGI GGATG 1 cut(s) 178
BseJI GATNNNNATC 1 cut(s) 221
BseLI CCNNNNNNNGG 1 cut(s) 188
BseMII CTCAG 1 cut(s) 137
BseYI CCCAGC 1 cut(s) 204
BslI CCNNNNNNNGG 1 cut(s) 188
BspCNI CTCAG 1 cut(s) 138
BspLI GGNNCC 1 cut(s) 105
BspOI GCTAGC 1 cut(s) 30
BstC8I GCNNGC 1 cut(s) 28
BstDEI CTNAG 1 cut(s) 146
BstF5I GGATG 1 cut(s) 178
BsuI GTATCC 2 cut(s) 164, 210
BtsCI GGATG 1 cut(s) 178
Cac8I GCNNGC 1 cut(s) 28
CviAII CATG 1 cut(s) 200
CviJI RGCY 4 cut(s) 57, 84, 155, 204
CviKI_1 RGCY 4 cut(s) 57, 84, 155, 204
DdeI CTNAG 1 cut(s) 146
Eco32I GATATC 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 177
EcoRV GATATC 1 cut(s) 46
FaeI CATG 1 cut(s) 203
FaiI YATR 5 cut(s) 72, 115, 194, 201, 222
FatI CATG 1 cut(s) 199
FokI GGATG 1 cut(s) 165
FspBI CTAG 2 cut(s) 27, 226
GsaI CCCAGC 1 cut(s) 208
Hin1II CATG 1 cut(s) 203
HinfI GANTC 1 cut(s) 148
Hpy188I TCNGA 1 cut(s) 43
Hpy188III TCNNGA 1 cut(s) 137
HpyCH4V TGCA 1 cut(s) 65
HpyF3I CTNAG 1 cut(s) 146
Hsp92II CATG 1 cut(s) 203
LpnPI CCDG 3 cut(s) 98, 122, 190
MaeI CTAG 2 cut(s) 27, 226
MboII GAAGA 3 cut(s) 100, 170, 173
MluCI AATT 3 cut(s) 21, 164, 210
MlyI GAGTC 1 cut(s) 157
MmeI TCCRAC 2 cut(s) 55, 206
MnlI CCTC 1 cut(s) 27
NheI GCTAGC 1 cut(s) 26
NlaIII CATG 1 cut(s) 203
NlaIV GGNNCC 1 cut(s) 105
PcsI WCGNNNNNNNCGW 1 cut(s) 16
PflMI CCANNNNNTGG 1 cut(s) 188
PleI GAGTC 1 cut(s) 156
PpsI GAGTC 1 cut(s) 156
PspFI CCCAGC 1 cut(s) 204
PspN4I GGNNCC 1 cut(s) 105
SchI GAGTC 1 cut(s) 157
SetI ASST 3 cut(s) 59, 130, 157
SgeI CNNG 8 cut(s) 30, 39, 97, 149, 164, 198, 212, 217
Sse9I AATT 3 cut(s) 21, 164, 210
SspMI CTAG 2 cut(s) 27, 226
TaqI TCGA 2 cut(s) 10, 19
TasI AATT 3 cut(s) 21, 164, 210
Van91I CCANNNNNTGG 1 cut(s) 188
XapI RAATTY 2 cut(s) 164, 210
XspI CTAG 2 cut(s) 27, 226
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.