Rorug07G0250600

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000007
Physical Location & Seq
Reverse (-)
23199219 .. 23199518
300 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug07G0250600.1

Sequence Viewer

Length: 300 bp
ATGGGTTTCAAGCTGCCTGGAATTGTTAGCCCCAAAAGAAGTCTTACCCGATCTTCATCTAATGCAAACAAGACAGCTTCAAAGACATTAGATATCCCAAAAGGCTATTTTGCGGTCTATGTTGGAGAGAGCCAGAAGAAGCGATTTGTGATTCCAATATCATACTTGAACCAACCTTCATTCATGGATTTGCTGAGTCAAGCTGAAGAAGAATTTGGATACGATCATCCCATGGGCGGTATCACAATTCCATGCAGTGAGGACACCTTCCTTGATCTCACTTCCAGCTTAAGTGTGTGA

Protein Analysis

99

Amino Acids

10.88

Weight (kDa)

6.55

Isoelectric Point (pI)

50.19

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Auxin_inducible PF02519 15 - 97 1.7e-24 Auxin responsive protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 113, 237
AcsI RAATTY 1 cut(s) 212
AcuI CTGAAG 1 cut(s) 225
AfiI CCNNNNNNNGG 1 cut(s) 236
AflII CTTAAG 1 cut(s) 289
AgsI TTSAA 3 cut(s) 10, 81, 169
AjnI CCWGG 1 cut(s) 16
AjuI GAANNNNNNNTTGG 2 cut(s) 198, 230
AluBI AGCT 4 cut(s) 13, 77, 203, 288
AluI AGCT 4 cut(s) 13, 77, 203, 288
ApeKI GCWGC 1 cut(s) 13
ApoI RAATTY 1 cut(s) 212
BciT130I CCWGG 1 cut(s) 18
BciVI GTATCC 1 cut(s) 212
BfrI CTTAAG 1 cut(s) 289
BfuI GTATCC 1 cut(s) 212
BisI GCNGC 1 cut(s) 14
BlsI GCNGC 1 cut(s) 15
Bme1390I CCNGG 1 cut(s) 18
BmrFI CCNGG 1 cut(s) 18
BsaBI GATNNNNATC 1 cut(s) 55
BsaJI CCNNGG 1 cut(s) 231
Bsc4I CCNNNNNNNGG 1 cut(s) 236
Bse8I GATNNNNATC 1 cut(s) 55
BseBI CCWGG 1 cut(s) 18
BseDI CCNNGG 1 cut(s) 231
BseGI GGATG 1 cut(s) 226
BseJI GATNNNNATC 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 236
BseMII CTCAG 1 cut(s) 185
BslI CCNNNNNNNGG 1 cut(s) 236
Bsp143I GATC 3 cut(s) 50, 223, 274
Bsp19I CCATGG 1 cut(s) 231
BspACI CCGC 2 cut(s) 113, 237
BspCNI CTCAG 1 cut(s) 186
BspTI CTTAAG 1 cut(s) 289
BssECI CCNNGG 1 cut(s) 231
BssMI GATC 3 cut(s) 50, 223, 274
BssT1I CCWWGG 1 cut(s) 231
Bst2UI CCWGG 1 cut(s) 18
BstAFI CTTAAG 1 cut(s) 289
BstDEI CTNAG 1 cut(s) 194
BstDSI CCRYGG 1 cut(s) 231
BstF5I GGATG 1 cut(s) 226
BstKTI GATC 3 cut(s) 53, 226, 277
BstMBI GATC 3 cut(s) 50, 223, 274
BstNI CCWGG 1 cut(s) 18
BstSCI CCNGG 1 cut(s) 16
BsuI GTATCC 1 cut(s) 212
BtgI CCRYGG 1 cut(s) 231
BtsCI GGATG 1 cut(s) 226
BtsI GCAGTG 1 cut(s) 262
BtsIMutI CAGTG 1 cut(s) 262
CviAII CATG 3 cut(s) 184, 232, 252
CviJI RGCY 7 cut(s) 13, 30, 77, 105, 132, 203, 288
CviKI_1 RGCY 7 cut(s) 13, 30, 77, 105, 132, 203, 288
DdeI CTNAG 1 cut(s) 194
DpnI GATC 3 cut(s) 52, 225, 276
DpnII GATC 3 cut(s) 50, 223, 274
Eco130I CCWWGG 1 cut(s) 231
Eco32I GATATC 1 cut(s) 94
Eco57I CTGAAG 1 cut(s) 225
EcoRII CCWGG 1 cut(s) 16
EcoRV GATATC 1 cut(s) 94
EcoT14I CCWWGG 1 cut(s) 231
ErhI CCWWGG 1 cut(s) 231
FaeI CATG 3 cut(s) 187, 235, 255
FaiI YATR 5 cut(s) 120, 163, 185, 233, 253
FatI CATG 3 cut(s) 183, 231, 251
Fnu4HI GCNGC 1 cut(s) 14
FokI GGATG 1 cut(s) 213
Fsp4HI GCNGC 1 cut(s) 14
GluI GCNGC 1 cut(s) 14
Hin1II CATG 3 cut(s) 187, 235, 255
HinfI GANTC 2 cut(s) 151, 196
HpyAV CCTTC 2 cut(s) 186, 277
HpyCH4V TGCA 2 cut(s) 65, 255
HpyF3I CTNAG 1 cut(s) 194
Hsp92II CATG 3 cut(s) 187, 235, 255
Kzo9I GATC 3 cut(s) 50, 223, 274
LpnPI CCDG 3 cut(s) 3, 30, 146
MalI GATC 3 cut(s) 52, 225, 276
MboI GATC 3 cut(s) 50, 223, 274
MboII GAAGA 4 cut(s) 45, 148, 218, 221
MluCI AATT 3 cut(s) 21, 212, 246
MlyI GAGTC 1 cut(s) 205
MmeI TCCRAC 1 cut(s) 103
MnlI CCTC 1 cut(s) 253
MseI TTAA 1 cut(s) 290
MspCI CTTAAG 1 cut(s) 289
MspR9I CCNGG 1 cut(s) 18
MvaI CCWGG 1 cut(s) 18
NcoI CCATGG 1 cut(s) 231
NdeII GATC 3 cut(s) 50, 223, 274
NlaIII CATG 3 cut(s) 187, 235, 255
PfeI GAWTC 1 cut(s) 151
PkrI GCNGC 1 cut(s) 15
PleI GAGTC 1 cut(s) 204
PpsI GAGTC 1 cut(s) 204
Psp6I CCWGG 1 cut(s) 16
PspGI CCWGG 1 cut(s) 16
SaqAI TTAA 1 cut(s) 290
SatI GCNGC 1 cut(s) 14
Sau3AI GATC 3 cut(s) 50, 223, 274
SchI GAGTC 1 cut(s) 205
ScrFI CCNGG 1 cut(s) 18
SetI ASST 6 cut(s) 15, 79, 178, 205, 269, 290
SmlI CTYRAG 1 cut(s) 289
SmoI CTYRAG 1 cut(s) 289
Sse9I AATT 3 cut(s) 21, 212, 246
SsiI CCGC 2 cut(s) 113, 237
StyD4I CCNGG 1 cut(s) 16
StyI CCWWGG 1 cut(s) 231
TasI AATT 3 cut(s) 21, 212, 246
TfiI GAWTC 1 cut(s) 151
Tru1I TTAA 1 cut(s) 290
Tru9I TTAA 1 cut(s) 290
TscAI CASTG 1 cut(s) 262
TseI GCWGC 1 cut(s) 13
TspDTI ATGAA 3 cut(s) 45, 168, 172
TspRI CASTG 1 cut(s) 262
Vha464I CTTAAG 1 cut(s) 289
XapI RAATTY 1 cut(s) 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.