Rh1AG137100

UPF0481 protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Reverse (-)
25957136 .. 25958585
1450 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG137100.1

Sequence Viewer

Length: 339 bp
ATGCTCCGAGATTGCCCTAAGTTCGAGAAATACTATGAGGCAAGGGCAGTAGCAATTGGTCCTTTCCATCATGATAAAGCAAGACCTTTCTTTGGTGTTCTAGCAGCTCTGGGGTTAATCAGCATCCAGACTTGGTACACAATCAGTTCTCCATCCACTGCCCGTGATGCTGTATGCAGTCCAAATTCTGGTTCATCCTTTTGTCAGGCTTCAAAGGTGCTATATGTAGTAGGGAAAAACAGCAAGAATCATAAACTAGTTGCTGCACTAAAACTCAAGGGTTTTATTCCATCTTATTTGAATTGGCCTGTTCAGAAGTTGGGAACAGTATGTAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

112

Amino Acids

12.3

Weight (kDa)

9.66

Isoelectric Point (pI)

25.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 188
AcsI RAATTY 1 cut(s) 184
AfaI GTAC 1 cut(s) 137
AfiI CCNNNNNNNGG 2 cut(s) 92, 188
AgsI TTSAA 2 cut(s) 213, 301
AhlI ACTAGT 1 cut(s) 256
AjuI GAANNNNNNNTTGG 2 cut(s) 175, 207
AluBI AGCT 1 cut(s) 107
AluI AGCT 1 cut(s) 107
AoxI GGCC 1 cut(s) 305
ApeKI GCWGC 2 cut(s) 104, 263
ApoI RAATTY 1 cut(s) 184
AspS9I GGNCC 1 cut(s) 59
AvaII GGWCC 1 cut(s) 59
BbvI GCAGC 2 cut(s) 116, 250
BccI CCATC 3 cut(s) 75, 160, 298
BcuI ACTAGT 1 cut(s) 256
BfaI CTAG 2 cut(s) 101, 257
BisI GCNGC 2 cut(s) 105, 264
BlsI GCNGC 2 cut(s) 106, 265
Bme18I GGWCC 1 cut(s) 59
BmgT120I GGNCC 1 cut(s) 59
BmsI GCATC 2 cut(s) 132, 157
BpuEI CTTGAG 1 cut(s) 260
Bsc4I CCNNNNNNNGG 2 cut(s) 92, 188
BseGI GGATG 3 cut(s) 123, 152, 194
BseLI CCNNNNNNNGG 2 cut(s) 92, 188
BseXI GCAGC 2 cut(s) 116, 250
BsgI GTGCAG 1 cut(s) 249
BshFI GGCC 1 cut(s) 307
BslI CCNNNNNNNGG 2 cut(s) 92, 188
BsnI GGCC 1 cut(s) 307
BspANI GGCC 1 cut(s) 307
BspHI TCATGA 1 cut(s) 70
Bst4CI ACNGT 1 cut(s) 328
BstDEI CTNAG 1 cut(s) 18
BstF5I GGATG 3 cut(s) 123, 152, 194
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstV1I GCAGC 2 cut(s) 116, 250
BsuRI GGCC 1 cut(s) 307
BtsCI GGATG 3 cut(s) 123, 152, 194
BtsI GCAGTG 1 cut(s) 156
BtsIMutI CAGTG 1 cut(s) 156
CciI TCATGA 1 cut(s) 70
Cfr13I GGNCC 1 cut(s) 59
Csp6I GTAC 1 cut(s) 136
CviAII CATG 1 cut(s) 71
CviJI RGCY 3 cut(s) 107, 209, 307
CviKI_1 RGCY 3 cut(s) 107, 209, 307
CviQI GTAC 1 cut(s) 136
DdeI CTNAG 1 cut(s) 18
Eco47I GGWCC 1 cut(s) 59
FaeI CATG 1 cut(s) 74
FaiI YATR 7 cut(s) 36, 72, 175, 223, 225, 252, 331
FatI CATG 1 cut(s) 70
Fnu4HI GCNGC 2 cut(s) 105, 264
FokI GGATG 3 cut(s) 110, 139, 181
Fsp4HI GCNGC 2 cut(s) 105, 264
FspBI CTAG 2 cut(s) 101, 257
GluI GCNGC 2 cut(s) 105, 264
HaeIII GGCC 1 cut(s) 307
Hin1II CATG 1 cut(s) 74
HinfI GANTC 1 cut(s) 247
Hpy166II GTNNAC 1 cut(s) 138
Hpy188I TCNGA 2 cut(s) 8, 315
Hpy188III TCNNGA 3 cut(s) 25, 71, 127
Hpy8I GTNNAC 1 cut(s) 138
HpyCH4III ACNGT 1 cut(s) 328
HpyCH4V TGCA 2 cut(s) 177, 266
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
HpyF3I CTNAG 1 cut(s) 18
Hsp92II CATG 1 cut(s) 74
LmnI GCTCC 1 cut(s) 9
LpnPI CCDG 5 cut(s) 95, 140, 174, 191, 321
Lsp1109I GCAGC 2 cut(s) 116, 250
LweI GCATC 2 cut(s) 132, 157
MaeI CTAG 2 cut(s) 101, 257
MfeI CAATTG 1 cut(s) 54
MluCI AATT 3 cut(s) 54, 184, 301
MnlI CCTC 1 cut(s) 31
MseI TTAA 1 cut(s) 116
MunI CAATTG 1 cut(s) 54
MwoI GCNNNNNNNGC 1 cut(s) 167
NlaIII CATG 1 cut(s) 74
PagI TCATGA 1 cut(s) 70
PfeI GAWTC 1 cut(s) 247
PflMI CCANNNNNTGG 1 cut(s) 188
PkrI GCNGC 2 cut(s) 106, 265
PspPI GGNCC 1 cut(s) 59
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
SaqAI TTAA 1 cut(s) 116
SatI GCNGC 2 cut(s) 105, 264
Sau96I GGNCC 1 cut(s) 59
SetI ASST 3 cut(s) 88, 109, 219
SfaNI GCATC 2 cut(s) 132, 157
SinI GGWCC 1 cut(s) 59
SmlI CTYRAG 1 cut(s) 275
SmoI CTYRAG 1 cut(s) 275
SpeI ACTAGT 1 cut(s) 256
Sse9I AATT 3 cut(s) 54, 184, 301
SspMI CTAG 2 cut(s) 101, 257
TaaI ACNGT 1 cut(s) 328
TaqI TCGA 1 cut(s) 24
TasI AATT 3 cut(s) 54, 184, 301
TfiI GAWTC 1 cut(s) 247
Tru1I TTAA 1 cut(s) 116
Tru9I TTAA 1 cut(s) 116
TscAI CASTG 1 cut(s) 163
TseI GCWGC 2 cut(s) 104, 263
TspDTI ATGAA 1 cut(s) 183
TspRI CASTG 1 cut(s) 163
Van91I CCANNNNNTGG 1 cut(s) 188
VpaK11BI GGWCC 1 cut(s) 59
XapI RAATTY 1 cut(s) 184
XspI CTAG 2 cut(s) 101, 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.