Rh1CG129300

UPF0481 protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
Physical Location & Seq
Reverse (-)
28459756 .. 28460832
1077 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG129300.1

Sequence Viewer

Length: 363 bp
ATGTTCCTTGTAAGAAAATTATCAATTGCGTTCTTCAAGTCCTCTTTGTCACTTAAGCTCATCAATTGCTTGAGGACTTGGACCTTGTTGCTTCTTCATCATAGCAGACCTTTCTTTGGTGTTCTAGCAGCTCTGGGGTTAATCAGCATCCAGACTTGGTACACAATCAGTTCTCCATCCACTGCCCGTGATGCTGTATGCAGTCCAAATTCTGGTTCATCCTTTTGTCAGGCTTCAAAGGTGCTATATGTAGTAGGGAAAAACAGCAAGAATCATAAACTAGTTGCTGCACTAAAACTCAAGGGTTTTATTCCATCTTATTTGAATTGGCCTGTTCAGAAGTTGGGAACAGTATGTAGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.23

Weight (kDa)

10.23

Isoelectric Point (pI)

19.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 212
AcsI RAATTY 1 cut(s) 208
AfaI GTAC 1 cut(s) 161
AfiI CCNNNNNNNGG 2 cut(s) 116, 212
AflII CTTAAG 1 cut(s) 53
AgsI TTSAA 3 cut(s) 37, 237, 325
AhlI ACTAGT 1 cut(s) 280
AjuI GAANNNNNNNTTGG 2 cut(s) 199, 231
AluBI AGCT 2 cut(s) 58, 131
AluI AGCT 2 cut(s) 58, 131
AoxI GGCC 1 cut(s) 329
ApeKI GCWGC 2 cut(s) 128, 287
ApoI RAATTY 1 cut(s) 208
AspS9I GGNCC 1 cut(s) 81
AvaII GGWCC 1 cut(s) 81
BbvI GCAGC 2 cut(s) 140, 274
BccI CCATC 2 cut(s) 184, 322
BcuI ACTAGT 1 cut(s) 280
BfaI CTAG 2 cut(s) 125, 281
BfrI CTTAAG 1 cut(s) 53
BisI GCNGC 2 cut(s) 129, 288
BlsI GCNGC 2 cut(s) 130, 289
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 1 cut(s) 81
BmsI GCATC 2 cut(s) 156, 181
BpuEI CTTGAG 2 cut(s) 91, 284
Bsc4I CCNNNNNNNGG 2 cut(s) 116, 212
BseGI GGATG 3 cut(s) 147, 176, 218
BseLI CCNNNNNNNGG 2 cut(s) 116, 212
BseXI GCAGC 2 cut(s) 140, 274
BsgI GTGCAG 1 cut(s) 273
BshFI GGCC 1 cut(s) 331
BslI CCNNNNNNNGG 2 cut(s) 116, 212
BsnI GGCC 1 cut(s) 331
BspANI GGCC 1 cut(s) 331
BspTI CTTAAG 1 cut(s) 53
Bst4CI ACNGT 1 cut(s) 352
BstAFI CTTAAG 1 cut(s) 53
BstF5I GGATG 3 cut(s) 147, 176, 218
BstMWI GCNNNNNNNGC 1 cut(s) 191
BstV1I GCAGC 2 cut(s) 140, 274
BsuRI GGCC 1 cut(s) 331
BtsCI GGATG 3 cut(s) 147, 176, 218
BtsI GCAGTG 1 cut(s) 180
BtsIMutI CAGTG 1 cut(s) 180
Cfr13I GGNCC 1 cut(s) 81
Csp6I GTAC 1 cut(s) 160
CviJI RGCY 4 cut(s) 58, 131, 233, 331
CviKI_1 RGCY 4 cut(s) 58, 131, 233, 331
CviQI GTAC 1 cut(s) 160
Eco47I GGWCC 1 cut(s) 81
FaiI YATR 6 cut(s) 102, 199, 247, 249, 276, 355
Fnu4HI GCNGC 2 cut(s) 129, 288
FokI GGATG 3 cut(s) 134, 163, 205
Fsp4HI GCNGC 2 cut(s) 129, 288
FspBI CTAG 2 cut(s) 125, 281
GluI GCNGC 2 cut(s) 129, 288
HaeIII GGCC 1 cut(s) 331
HinfI GANTC 1 cut(s) 271
Hpy166II GTNNAC 1 cut(s) 162
Hpy188I TCNGA 1 cut(s) 339
Hpy188III TCNNGA 1 cut(s) 151
Hpy8I GTNNAC 1 cut(s) 162
HpyCH4III ACNGT 1 cut(s) 352
HpyCH4V TGCA 2 cut(s) 201, 290
HpyF10VI GCNNNNNNNGC 1 cut(s) 191
LpnPI CCDG 5 cut(s) 119, 164, 198, 215, 345
Lsp1109I GCAGC 2 cut(s) 140, 274
LweI GCATC 2 cut(s) 156, 181
MaeI CTAG 2 cut(s) 125, 281
MaeIII GTNAC 1 cut(s) 48
MboII GAAGA 2 cut(s) 25, 86
MfeI CAATTG 2 cut(s) 24, 64
MluCI AATT 5 cut(s) 17, 24, 64, 208, 325
MnlI CCTC 2 cut(s) 52, 66
MseI TTAA 2 cut(s) 54, 140
MspCI CTTAAG 1 cut(s) 53
MunI CAATTG 2 cut(s) 24, 64
MwoI GCNNNNNNNGC 1 cut(s) 191
NmuCI GTSAC 1 cut(s) 48
PfeI GAWTC 1 cut(s) 271
PflMI CCANNNNNTGG 1 cut(s) 212
PkrI GCNGC 2 cut(s) 130, 289
PspPI GGNCC 1 cut(s) 81
RsaI GTAC 1 cut(s) 161
RsaNI GTAC 1 cut(s) 160
SaqAI TTAA 2 cut(s) 54, 140
SatI GCNGC 2 cut(s) 129, 288
Sau96I GGNCC 1 cut(s) 81
SetI ASST 5 cut(s) 60, 86, 112, 133, 243
SfaNI GCATC 2 cut(s) 156, 181
SinI GGWCC 1 cut(s) 81
SmlI CTYRAG 3 cut(s) 53, 70, 299
SmoI CTYRAG 3 cut(s) 53, 70, 299
SpeI ACTAGT 1 cut(s) 280
Sse9I AATT 5 cut(s) 17, 24, 64, 208, 325
SspMI CTAG 2 cut(s) 125, 281
TaaI ACNGT 1 cut(s) 352
TasI AATT 5 cut(s) 17, 24, 64, 208, 325
TfiI GAWTC 1 cut(s) 271
Tru1I TTAA 2 cut(s) 54, 140
Tru9I TTAA 2 cut(s) 54, 140
TscAI CASTG 1 cut(s) 187
TseFI GTSAC 1 cut(s) 48
TseI GCWGC 2 cut(s) 128, 287
Tsp45I GTSAC 1 cut(s) 48
TspDTI ATGAA 2 cut(s) 86, 207
TspRI CASTG 1 cut(s) 187
Van91I CCANNNNNTGG 1 cut(s) 212
Vha464I CTTAAG 1 cut(s) 53
VpaK11BI GGWCC 1 cut(s) 81
XapI RAATTY 1 cut(s) 208
XspI CTAG 2 cut(s) 125, 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.