Rh1AG304200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
OG0011527
Physical Location & Seq
Forward (+)
53653557 .. 53659410
5854 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG304200.1

Sequence Viewer

Length: 276 bp
ATGAAGAGGGACCGGGCCGGAATCTCAATTTCAGAATCGGAGGACGGCGGCGTCAGCTACACGCTTAATTTGGAGGATGACTCCACACGCGTCGACGACATCCTCCTCCGATCGCGGCTGTCGGCCTTCGCCTCTTGGAGTCTAACCTCGCCGGAGAAGTCGACCACAATCCGGCATATTCAGGACGACGTTCTAGAGGAAGATGAGGATAATCGGAGTTGGAGGTCACCGACGGAGAACAATCTGAAGGAGAAGCGTCACCGATTGATGTGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.51

Weight (kDa)

4.97

Isoelectric Point (pI)

79.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 50
AccI GTMKAC 2 cut(s) 93, 161
AccII CGCG 2 cut(s) 90, 115
AciI CCGC 2 cut(s) 48, 115
AcuI CTGAAG 1 cut(s) 266
AcyI GRCGYC 1 cut(s) 51
AfiI CCNNNNNNNGG 1 cut(s) 171
AflIII ACRYGT 1 cut(s) 88
AluBI AGCT 1 cut(s) 57
AluI AGCT 1 cut(s) 57
AoxI GGCC 2 cut(s) 15, 123
AspS9I GGNCC 2 cut(s) 10, 15
AsuC2I CCSGG 1 cut(s) 14
AsuHPI GGTGA 2 cut(s) 219, 251
AvaII GGWCC 1 cut(s) 10
BceAI ACGGC 1 cut(s) 61
BcgI CGANNNNNNTGC 1 cut(s) 252
BcnI CCSGG 1 cut(s) 14
BfaI CTAG 1 cut(s) 194
BisI GCNGC 2 cut(s) 49, 116
BlsI GCNGC 2 cut(s) 50, 117
Bme1390I CCNGG 1 cut(s) 14
Bme18I GGWCC 1 cut(s) 10
BmgT120I GGNCC 2 cut(s) 10, 15
BmiI GGNNCC 1 cut(s) 11
BmrFI CCNGG 1 cut(s) 14
BplI GAGNNNNNCTC 2 cut(s) 65, 97
BpuMI CCSGG 1 cut(s) 14
BsaHI GRCGYC 1 cut(s) 51
Bsc4I CCNNNNNNNGG 1 cut(s) 171
BseGI GGATG 2 cut(s) 82, 99
BseLI CCNNNNNNNGG 1 cut(s) 171
BseRI GAGGAG 1 cut(s) 95
Bsh1236I CGCG 2 cut(s) 90, 115
Bsh1285I CGRYCG 1 cut(s) 113
BshFI GGCC 2 cut(s) 17, 125
BsiEI CGRYCG 1 cut(s) 113
BsiSI CCGG 4 cut(s) 13, 18, 152, 172
BslFI GGGAC 1 cut(s) 23
BslI CCNNNNNNNGG 1 cut(s) 171
BsmFI GGGAC 1 cut(s) 23
BsnI GGCC 2 cut(s) 17, 125
Bsp143I GATC 1 cut(s) 110
BspACI CCGC 2 cut(s) 48, 115
BspANI GGCC 2 cut(s) 17, 125
BspFNI CGCG 2 cut(s) 90, 115
BspLI GGNNCC 1 cut(s) 11
BssMI GATC 1 cut(s) 110
BssNI GRCGYC 1 cut(s) 51
BstACI GRCGYC 1 cut(s) 51
BstEII GGTNACC 1 cut(s) 225
BstF5I GGATG 2 cut(s) 82, 99
BstFNI CGCG 2 cut(s) 90, 115
BstKTI GATC 1 cut(s) 113
BstMBI GATC 1 cut(s) 110
BstMCI CGRYCG 1 cut(s) 113
BstMWI GCNNNNNNNGC 1 cut(s) 54
BstPI GGTNACC 1 cut(s) 225
BstSCI CCNGG 1 cut(s) 12
BstUI CGCG 2 cut(s) 90, 115
BsuRI GGCC 2 cut(s) 17, 125
BtsCI GGATG 2 cut(s) 82, 99
Cfr13I GGNCC 2 cut(s) 10, 15
CseI GACGC 3 cut(s) 40, 79, 245
CviJI RGCY 4 cut(s) 17, 57, 118, 125
CviKI_1 RGCY 4 cut(s) 17, 57, 118, 125
DpnI GATC 1 cut(s) 112
DpnII GATC 1 cut(s) 110
DrdI GACNNNNNNGTC 1 cut(s) 50
DseDI GACNNNNNNGTC 1 cut(s) 50
Eco47I GGWCC 1 cut(s) 10
Eco57I CTGAAG 1 cut(s) 266
Eco91I GGTNACC 1 cut(s) 225
EcoO65I GGTNACC 1 cut(s) 225
FaiI YATR 1 cut(s) 177
FaqI GGGAC 1 cut(s) 23
FblI GTMKAC 2 cut(s) 93, 161
Fnu4HI GCNGC 2 cut(s) 49, 116
FokI GGATG 2 cut(s) 86, 89
Fsp4HI GCNGC 2 cut(s) 49, 116
FspBI CTAG 1 cut(s) 194
GluI GCNGC 2 cut(s) 49, 116
HaeIII GGCC 2 cut(s) 17, 125
HapII CCGG 4 cut(s) 13, 18, 152, 172
HgaI GACGC 3 cut(s) 40, 79, 245
Hin1I GRCGYC 1 cut(s) 51
HincII GTYRAC 2 cut(s) 94, 162
HindII GTYRAC 2 cut(s) 94, 162
HinfI GANTC 4 cut(s) 21, 35, 80, 139
HpaII CCGG 4 cut(s) 13, 18, 152, 172
HphI GGTGA 2 cut(s) 219, 251
Hpy166II GTNNAC 2 cut(s) 94, 162
Hpy188I TCNGA 5 cut(s) 34, 40, 110, 216, 246
Hpy188III TCNNGA 2 cut(s) 182, 194
Hpy8I GTNNAC 2 cut(s) 94, 162
Hpy99I CGWCG 4 cut(s) 95, 98, 191, 235
HpyAV CCTTC 2 cut(s) 136, 241
HpyCH4IV ACGT 1 cut(s) 189
HpyF10VI GCNNNNNNNGC 1 cut(s) 54
HpySE526I ACGT 1 cut(s) 189
Hsp92I GRCGYC 1 cut(s) 51
Kzo9I GATC 1 cut(s) 110
LpnPI CCDG 5 cut(s) 26, 31, 165, 167, 185
MaeI CTAG 1 cut(s) 194
MaeII ACGT 1 cut(s) 189
MaeIII GTNAC 2 cut(s) 225, 257
MalI GATC 1 cut(s) 112
MboI GATC 1 cut(s) 110
MboII GAAGA 2 cut(s) 16, 212
MluCI AATT 2 cut(s) 27, 67
MluI ACGCGT 1 cut(s) 88
MlyI GAGTC 2 cut(s) 74, 148
MmeI TCCRAC 1 cut(s) 200
MnlI CCTC 9 cut(s) 34, 67, 113, 116, 142, 157, 190, 199, 216
MseI TTAA 1 cut(s) 66
MspI CCGG 4 cut(s) 13, 18, 152, 172
MspR9I CCNGG 1 cut(s) 14
MvnI CGCG 2 cut(s) 90, 115
MwoI GCNNNNNNNGC 1 cut(s) 54
NciI CCSGG 1 cut(s) 14
NdeII GATC 1 cut(s) 110
NlaIV GGNNCC 1 cut(s) 11
NmuCI GTSAC 2 cut(s) 225, 257
PfeI GAWTC 2 cut(s) 21, 35
PkrI GCNGC 2 cut(s) 50, 117
Ple19I CGATCG 1 cut(s) 113
PleI GAGTC 2 cut(s) 74, 147
PpsI GAGTC 2 cut(s) 74, 147
PspEI GGTNACC 1 cut(s) 225
PspN4I GGNNCC 1 cut(s) 11
PspPI GGNCC 2 cut(s) 10, 15
PvuI CGATCG 1 cut(s) 113
SalI GTCGAC 2 cut(s) 92, 160
SaqAI TTAA 1 cut(s) 66
SatI GCNGC 2 cut(s) 49, 116
Sau3AI GATC 1 cut(s) 110
Sau96I GGNCC 2 cut(s) 10, 15
SchI GAGTC 2 cut(s) 74, 148
ScrFI CCNGG 1 cut(s) 14
SetI ASST 4 cut(s) 59, 149, 192, 227
SgrDI CGTCGACG 1 cut(s) 92
SinI GGWCC 1 cut(s) 10
Sse9I AATT 2 cut(s) 27, 67
SsiI CCGC 2 cut(s) 48, 115
SspMI CTAG 1 cut(s) 194
StyD4I CCNGG 1 cut(s) 12
TaiI ACGT 1 cut(s) 192
TaqI TCGA 2 cut(s) 93, 161
TasI AATT 2 cut(s) 27, 67
TauI GCSGC 2 cut(s) 51, 118
TfiI GAWTC 2 cut(s) 21, 35
Tru1I TTAA 1 cut(s) 66
Tru9I TTAA 1 cut(s) 66
TseFI GTSAC 2 cut(s) 225, 257
Tsp45I GTSAC 2 cut(s) 225, 257
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 248
VpaK11BI GGWCC 1 cut(s) 10
XbaI TCTAGA 1 cut(s) 193
XmiI GTMKAC 2 cut(s) 93, 161
XspI CTAG 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.