Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr1C

Orthogroup ID

OG0016808

Physical Location & Seq

Genomic Coordinates Reverse (-)

10947619 .. 10966397

Gene Structure 18779 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh1CG056200.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 192 bp

ATGTGCGATATCTACTTTCAAGTGTTAACAAGGGAACCAGTGCGTTTCCAGGAAGATGTGATTGCAATCGGTGTTTTCCAAGCAACGGTGAAAGGGATACTAACCATAAACTCTGCAGGAAACAGTGGTCCTAGAGCTGGTTCTGTAACAAGCGTGGCACCATGGTTGCTCTCAGTGGCAGGCGGCAGCTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005576

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Inhibitor_I9 PA Peptidase_S8

Protein Analysis

63

Amino Acids

6.6

Weight (kDa)

5.97

Isoelectric Point (pI)

26.46

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016808)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g37161
malus_domestica	MD09G1128100.v1.1 MD11G1133600.v1.1
pyrus_communis	pycom01g09800 pycom01g09810 pycom03g06640 pycom07g09910
rosa_roxburghii	Rroxscaffold_4G00322790
rosa_samantha	Rh1AG055600 Rh1AG082700 Rh1CG056200 Rh1CG080700 Rh1DG060100 Rh1DG087300

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB1I	GGYRCC	1 cut(s)	157
AciI	CCGC	1 cut(s)	183
AfiI	CCNNNNNNNGG	2 cut(s)	85, 137
AgsI	TTSAA	1 cut(s)	20
AjnI	CCWGG	1 cut(s)	48
AluBI	AGCT	2 cut(s)	137, 189
AluI	AGCT	2 cut(s)	137, 189
ApeKI	GCWGC	1 cut(s)	186
AspS9I	GGNCC	1 cut(s)	128
AsuHPI	GGTGA	1 cut(s)	100
AvaII	GGWCC	1 cut(s)	128
BanI	GGYRCC	1 cut(s)	157
BciT130I	CCWGG	1 cut(s)	50
BciVI	GTATCC	1 cut(s)	90
BfaI	CTAG	2 cut(s)	132, 190
BfmI	CTRYAG	1 cut(s)	114
BfuI	GTATCC	1 cut(s)	90
BisI	GCNGC	2 cut(s)	184, 187
BlsI	GCNGC	2 cut(s)	185, 188
Bme1390I	CCNGG	1 cut(s)	50
Bme18I	GGWCC	1 cut(s)	128
BmgT120I	GGNCC	1 cut(s)	128
BmiI	GGNNCC	2 cut(s)	36, 159
BmrFI	CCNGG	1 cut(s)	50
BsaBI	GATNNNNATC	1 cut(s)	65
BsaJI	CCNNGG	1 cut(s)	161
Bsc4I	CCNNNNNNNGG	2 cut(s)	85, 137
Bse1I	ACTGG	1 cut(s)	38
Bse8I	GATNNNNATC	1 cut(s)	65
BseBI	CCWGG	1 cut(s)	50
BseDI	CCNNGG	1 cut(s)	161
BseJI	GATNNNNATC	1 cut(s)	65
BseLI	CCNNNNNNNGG	2 cut(s)	85, 137
BseMII	CTCAG	1 cut(s)	186
BseNI	ACTGG	1 cut(s)	38
BshNI	GGYRCC	1 cut(s)	157
BslI	CCNNNNNNNGG	2 cut(s)	85, 137
Bsp19I	CCATGG	1 cut(s)	161
BspACI	CCGC	1 cut(s)	183
BspCNI	CTCAG	1 cut(s)	185
BspLI	GGNNCC	2 cut(s)	36, 159
BspMAI	CTGCAG	1 cut(s)	118
BspT107I	GGYRCC	1 cut(s)	157
BsrI	ACTGG	1 cut(s)	38
BssECI	CCNNGG	1 cut(s)	161
BssT1I	CCWWGG	1 cut(s)	161
Bst2UI	CCWGG	1 cut(s)	50
Bst4CI	ACNGT	2 cut(s)	88, 125
BstC8I	GCNNGC	1 cut(s)	181
BstDEI	CTNAG	1 cut(s)	172
BstDSI	CCRYGG	1 cut(s)	161
BstNI	CCWGG	1 cut(s)	50
BstSCI	CCNGG	1 cut(s)	48
BstSFI	CTRYAG	1 cut(s)	114
BsuI	GTATCC	1 cut(s)	90
BtgI	CCRYGG	1 cut(s)	161
BtsIMutI	CAGTG	3 cut(s)	45, 130, 180
Cac8I	GCNNGC	1 cut(s)	181
Cfr13I	GGNCC	1 cut(s)	128
CviAII	CATG	1 cut(s)	162
CviJI	RGCY	2 cut(s)	137, 189
CviKI_1	RGCY	2 cut(s)	137, 189
DdeI	CTNAG	1 cut(s)	172
Eco130I	CCWWGG	1 cut(s)	161
Eco32I	GATATC	1 cut(s)	10
Eco47I	GGWCC	1 cut(s)	128
EcoRII	CCWGG	1 cut(s)	48
EcoRV	GATATC	1 cut(s)	10
EcoT14I	CCWWGG	1 cut(s)	161
ErhI	CCWWGG	1 cut(s)	161
FaeI	CATG	1 cut(s)	165
FaiI	YATR	2 cut(s)	107, 163
FatI	CATG	1 cut(s)	161
Fnu4HI	GCNGC	2 cut(s)	184, 187
Fsp4HI	GCNGC	2 cut(s)	184, 187
FspBI	CTAG	2 cut(s)	132, 190
GluI	GCNGC	2 cut(s)	184, 187
Hin1II	CATG	1 cut(s)	165
HincII	GTYRAC	1 cut(s)	27
HindII	GTYRAC	1 cut(s)	27
HpaI	GTTAAC	1 cut(s)	27
HphI	GGTGA	1 cut(s)	100
Hpy166II	GTNNAC	1 cut(s)	27
Hpy8I	GTNNAC	1 cut(s)	27
HpyCH4III	ACNGT	2 cut(s)	88, 125
HpyCH4V	TGCA	2 cut(s)	65, 116
HpyF3I	CTNAG	1 cut(s)	172
Hsp92II	CATG	1 cut(s)	165
KspAI	GTTAAC	1 cut(s)	27
LpnPI	CCDG	6 cut(s)	35, 51, 62, 102, 123, 165
MaeI	CTAG	2 cut(s)	132, 190
MaeIII	GTNAC	1 cut(s)	145
MboII	GAAGA	1 cut(s)	65
MseI	TTAA	1 cut(s)	26
MspR9I	CCNGG	1 cut(s)	50
MvaI	CCWGG	1 cut(s)	50
NcoI	CCATGG	1 cut(s)	161
NlaIII	CATG	1 cut(s)	165
NlaIV	GGNNCC	2 cut(s)	36, 159
PfoI	TCCNGGA	1 cut(s)	48
PkrI	GCNGC	2 cut(s)	185, 188
Psp6I	CCWGG	1 cut(s)	48
PspGI	CCWGG	1 cut(s)	48
PspN4I	GGNNCC	2 cut(s)	36, 159
PspPI	GGNCC	1 cut(s)	128
PstI	CTGCAG	1 cut(s)	118
SaqAI	TTAA	1 cut(s)	26
SatI	GCNGC	2 cut(s)	184, 187
Sau96I	GGNCC	1 cut(s)	128
ScrFI	CCNGG	1 cut(s)	50
SetI	ASST	2 cut(s)	139, 191
SfcI	CTRYAG	1 cut(s)	114
SinI	GGWCC	1 cut(s)	128
SsiI	CCGC	1 cut(s)	183
SspMI	CTAG	2 cut(s)	132, 190
StyD4I	CCNGG	1 cut(s)	48
StyI	CCWWGG	1 cut(s)	161
TaaI	ACNGT	2 cut(s)	88, 125
TauI	GCSGC	1 cut(s)	186
Tru1I	TTAA	1 cut(s)	26
Tru9I	TTAA	1 cut(s)	26
TscAI	CASTG	3 cut(s)	45, 130, 180
TseI	GCWGC	1 cut(s)	186
TspRI	CASTG	3 cut(s)	45, 130, 180
VpaK11BI	GGWCC	1 cut(s)	128
XspI	CTAG	2 cut(s)	132, 190

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.