Rh1DG179700

DUF4210

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
36432696 .. 36436258
3563 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG179700.1

Sequence Viewer

Length: 303 bp
ATGGAAGAGCTTGCATCCATTGATCCCAGCAGACTAGGACTATTACTCTACAATGACTTGAGGGTTGTATTCCCTCAGAGAGAGTCAGATGCTGACGAGGGCAAGTTAAACGTGGAATATCATATCCCAGAAGATCCGAAATACTTTGACGTAGAGTGGAAACGTCTAATTGATCGAGCTGACAATATCTCTTTGTTATTTGTACCCCCTAATCTGCTTCTTAGTTATGGTAAGGTCATTGCTCAAATGGGTTGCACTCAAAATTGGAAATTGTTTTCTCCAAGTAGAATTATAAGTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.58

Weight (kDa)

4.86

Isoelectric Point (pI)

47.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Chromosome_seg PF13889 16 - 50 1e-13 Chromosome segregation during meiosis
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 293
AclWI GGATC 2 cut(s) 17, 128
AfaI GTAC 1 cut(s) 204
AluBI AGCT 2 cut(s) 10, 179
AluI AGCT 2 cut(s) 10, 179
AlwI GGATC 2 cut(s) 17, 128
AlwNI CAGNNNCTG 1 cut(s) 92
BfaI CTAG 1 cut(s) 35
BmsI GCATC 2 cut(s) 23, 79
BpuEI CTTGAG 1 cut(s) 79
Bse3DI GCAATG 1 cut(s) 237
BseGI GGATG 1 cut(s) 14
BseMI GCAATG 1 cut(s) 237
BseMII CTCAG 1 cut(s) 89
BseYI CCCAGC 1 cut(s) 26
Bsp143I GATC 3 cut(s) 22, 133, 172
BspCNI CTCAG 1 cut(s) 88
BspPI GGATC 2 cut(s) 17, 128
BsrDI GCAATG 1 cut(s) 237
BssMI GATC 3 cut(s) 22, 133, 172
BstC8I GCNNGC 1 cut(s) 12
BstDEI CTNAG 2 cut(s) 75, 221
BstF5I GGATG 1 cut(s) 14
BstKTI GATC 3 cut(s) 25, 136, 175
BstMBI GATC 3 cut(s) 22, 133, 172
BstX2I RGATCY 1 cut(s) 133
BstYI RGATCY 1 cut(s) 133
BtsCI GGATG 1 cut(s) 14
Cac8I GCNNGC 1 cut(s) 12
CaiI CAGNNNCTG 1 cut(s) 92
Csp6I GTAC 1 cut(s) 203
CviJI RGCY 2 cut(s) 10, 179
CviKI_1 RGCY 2 cut(s) 10, 179
CviQI GTAC 1 cut(s) 203
DdeI CTNAG 2 cut(s) 75, 221
DpnI GATC 3 cut(s) 24, 135, 174
DpnII GATC 3 cut(s) 22, 133, 172
FaiI YATR 4 cut(s) 123, 228, 293, 299
FspBI CTAG 1 cut(s) 35
GsaI CCCAGC 1 cut(s) 30
HinfI GANTC 1 cut(s) 83
Hpy188I TCNGA 3 cut(s) 78, 88, 138
HpyCH4IV ACGT 3 cut(s) 111, 150, 163
HpyCH4V TGCA 2 cut(s) 14, 255
HpyF3I CTNAG 2 cut(s) 75, 221
HpySE526I ACGT 3 cut(s) 111, 150, 163
Kzo9I GATC 3 cut(s) 22, 133, 172
LpnPI CCDG 2 cut(s) 40, 141
LweI GCATC 2 cut(s) 23, 79
MaeI CTAG 1 cut(s) 35
MaeII ACGT 3 cut(s) 111, 150, 163
MalI GATC 3 cut(s) 24, 135, 174
MboI GATC 3 cut(s) 22, 133, 172
MboII GAAGA 2 cut(s) 17, 143
MflI RGATCY 1 cut(s) 133
MluCI AATT 4 cut(s) 168, 262, 269, 288
MlyI GAGTC 1 cut(s) 92
MnlI CCTC 3 cut(s) 54, 84, 91
MseI TTAA 1 cut(s) 107
NdeII GATC 3 cut(s) 22, 133, 172
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
PsiI TTATAA 1 cut(s) 293
PspFI CCCAGC 1 cut(s) 26
PstNI CAGNNNCTG 1 cut(s) 92
PsuI RGATCY 1 cut(s) 133
RsaI GTAC 1 cut(s) 204
RsaNI GTAC 1 cut(s) 203
SaqAI TTAA 1 cut(s) 107
Sau3AI GATC 3 cut(s) 22, 133, 172
SchI GAGTC 1 cut(s) 92
SetI ASST 6 cut(s) 12, 114, 153, 166, 181, 237
SfaNI GCATC 2 cut(s) 23, 79
SmlI CTYRAG 1 cut(s) 58
SmoI CTYRAG 1 cut(s) 58
Sse9I AATT 4 cut(s) 168, 262, 269, 288
SspMI CTAG 1 cut(s) 35
TaiI ACGT 3 cut(s) 114, 153, 166
TaqI TCGA 1 cut(s) 175
TasI AATT 4 cut(s) 168, 262, 269, 288
Tru1I TTAA 1 cut(s) 107
Tru9I TTAA 1 cut(s) 107
XspI CTAG 1 cut(s) 35
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.