Rh2AG105600

TIFY 3B-like

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2A
Physical Location & Seq
Forward (+)
9262957 .. 9266414
3458 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2AG105600.1

Sequence Viewer

Length: 228 bp
ATGGCTGAAAAATTTGAGCTTGGTGATGTGAAACAGCCCAAAGAAGAAGCTGAGGAAATTGAGGCCTCTACTAATGATCTGCCCAACATTAAGAGCAACAGAAACAAGCCATCTGCACTTACTATCCCTGCTCGTGCTCCTGCTCAGCTTACCATCTTCTACGCAGGGAGTGTTAGCGTCTTTGATGCAGTTACTGCAGAAAAGGTGAGATCTTATGAACTTCAATAA

Protein Analysis

75

Amino Acids

8.25

Weight (kDa)

4.85

Isoelectric Point (pI)

69.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
tify PF06200 46 - 70 1.3e-12 tify domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011174)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 11
AgsI TTSAA 1 cut(s) 224
AluBI AGCT 3 cut(s) 19, 50, 148
AluI AGCT 3 cut(s) 19, 50, 148
Alw21I GWGCWC 1 cut(s) 139
AlwNI CAGNNNCTG 1 cut(s) 194
AoxI GGCC 1 cut(s) 63
ApoI RAATTY 1 cut(s) 11
AsuHPI GGTGA 2 cut(s) 35, 217
BauI CACGAG 1 cut(s) 132
Bbv12I GWGCWC 1 cut(s) 139
BbvCI CCTCAGC 1 cut(s) 51
BccI CCATC 2 cut(s) 118, 161
BfmI CTRYAG 1 cut(s) 195
BglII AGATCT 1 cut(s) 209
BlpI GCTNAGC 1 cut(s) 144
BmsI GCATC 1 cut(s) 175
Bpu10I CCTNAGC 1 cut(s) 51
Bpu1102I GCTNAGC 1 cut(s) 144
BseMII CTCAG 2 cut(s) 42, 158
BsgI GTGCAG 1 cut(s) 99
BshFI GGCC 1 cut(s) 65
BsiHKAI GWGCWC 1 cut(s) 139
BsnI GGCC 1 cut(s) 65
Bsp1286I GDGCHC 1 cut(s) 139
Bsp143I GATC 2 cut(s) 76, 209
Bsp1720I GCTNAGC 1 cut(s) 144
BspANI GGCC 1 cut(s) 65
BspCNI CTCAG 2 cut(s) 43, 157
BspMAI CTGCAG 1 cut(s) 199
BssMI GATC 2 cut(s) 76, 209
BssSI CACGAG 1 cut(s) 132
Bst2BI CACGAG 1 cut(s) 132
BstAPI GCANNNNNTGC 1 cut(s) 194
BstDEI CTNAG 2 cut(s) 51, 144
BstKTI GATC 2 cut(s) 79, 212
BstMBI GATC 2 cut(s) 76, 209
BstMWI GCNNNNNNNGC 1 cut(s) 194
BstSFI CTRYAG 1 cut(s) 195
BstX2I RGATCY 1 cut(s) 209
BstYI RGATCY 1 cut(s) 209
BsuRI GGCC 1 cut(s) 65
CaiI CAGNNNCTG 1 cut(s) 194
CseI GACGC 1 cut(s) 166
CviJI RGCY 7 cut(s) 5, 19, 37, 50, 65, 109, 148
CviKI_1 RGCY 7 cut(s) 5, 19, 37, 50, 65, 109, 148
DdeI CTNAG 2 cut(s) 51, 144
DpnI GATC 2 cut(s) 78, 211
DpnII GATC 2 cut(s) 76, 209
Eco147I AGGCCT 1 cut(s) 65
FaiI YATR 1 cut(s) 216
HaeIII GGCC 1 cut(s) 65
HgaI GACGC 1 cut(s) 166
HphI GGTGA 2 cut(s) 35, 217
HpyCH4V TGCA 3 cut(s) 116, 188, 197
HpyF10VI GCNNNNNNNGC 1 cut(s) 194
HpyF3I CTNAG 2 cut(s) 51, 144
Kzo9I GATC 2 cut(s) 76, 209
LmnI GCTCC 1 cut(s) 142
LpnPI CCDG 3 cut(s) 141, 150, 153
LweI GCATC 1 cut(s) 175
MaeIII GTNAC 1 cut(s) 190
MalI GATC 2 cut(s) 78, 211
MboI GATC 2 cut(s) 76, 209
MboII GAAGA 2 cut(s) 56, 148
MflI RGATCY 1 cut(s) 209
MhlI GDGCHC 1 cut(s) 139
MluCI AATT 2 cut(s) 11, 57
MnlI CCTC 3 cut(s) 46, 55, 76
MseI TTAA 1 cut(s) 90
MwoI GCNNNNNNNGC 1 cut(s) 194
NdeII GATC 2 cut(s) 76, 209
PceI AGGCCT 1 cut(s) 65
PstI CTGCAG 1 cut(s) 199
PstNI CAGNNNCTG 1 cut(s) 194
PsuI RGATCY 1 cut(s) 209
SaqAI TTAA 1 cut(s) 90
Sau3AI GATC 2 cut(s) 76, 209
SduI GDGCHC 1 cut(s) 139
SetI ASST 4 cut(s) 21, 52, 150, 207
SfaNI GCATC 1 cut(s) 175
SfcI CTRYAG 1 cut(s) 195
SgeI CNNG 7 cut(s) 32, 118, 140, 144, 146, 152, 177
Sse9I AATT 2 cut(s) 11, 57
SseBI AGGCCT 1 cut(s) 65
StuI AGGCCT 1 cut(s) 65
TasI AATT 2 cut(s) 11, 57
Tru1I TTAA 1 cut(s) 90
Tru9I TTAA 1 cut(s) 90
XapI RAATTY 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.