Rh2CG200700

formamidase C869.04 isoform X1

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0003336
Physical Location & Seq
Forward (+)
19288303 .. 19289398
1096 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG200700.1

Sequence Viewer

Length: 396 bp
ATGGTAGACTGGACTGGAGGTGCTATTAACGATGATGACTCTGCAGTAGACGTAAAAAAACATAGACCTCTCAACTATGATGGAATTCCAGCACAGCCGACTGATCTTCTGGTAGTTGAGATATGCAACATGGGTCCTCTTCCAGGAGATGAATGGAGTTTCACAAGAACATTCGACAGAGAAAATGGAGGGGGTTTTCTGACTGATCATTTTCCTGGTGCAACCAAAGCTATTTGGTATGGTGAAGGGATATATGCCTACTCTCCTCAAATACCAGGAGTGAGATTCCCGGGTTTAACACACCCTGAAATAGTTGGAATAGCACCATCAATGGAACTCTTGAACAAATGGAATAAGAGGGAGAGAGAACTTGAGAAAATGGAGTCAAGTATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00460 ko00630 ko00910 ko01200 map00460 map00630 map00910 map01200
Pfam Domains
Protein Families
FmdA_AmdA

Protein Analysis

131

Amino Acids

14.61

Weight (kDa)

4.74

Isoelectric Point (pI)

38.66

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
FmdA_AmdA PF03069 1 - 126 8.9e-36 Acetamidase/Formamidase family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 6, 48
AcsI RAATTY 1 cut(s) 84
AfiI CCNNNNNNNGG 1 cut(s) 143
AgsI TTSAA 1 cut(s) 343
AjnI CCWGG 3 cut(s) 142, 214, 274
AluBI AGCT 1 cut(s) 230
AluI AGCT 1 cut(s) 230
Ama87I CYCGRG 1 cut(s) 289
ApoI RAATTY 1 cut(s) 84
AspS9I GGNCC 1 cut(s) 134
AsuC2I CCSGG 2 cut(s) 290, 291
AsuHPI GGTGA 1 cut(s) 254
AvaI CYCGRG 1 cut(s) 289
AvaII GGWCC 1 cut(s) 134
BccI CCATC 2 cut(s) 74, 334
BciT130I CCWGG 3 cut(s) 144, 216, 276
BclI TGATCA 1 cut(s) 205
BcnI CCSGG 2 cut(s) 290, 291
BfmI CTRYAG 1 cut(s) 42
Bme1390I CCNGG 5 cut(s) 144, 216, 276, 290, 291
Bme18I GGWCC 1 cut(s) 134
BmeT110I CYCGRG 1 cut(s) 289
BmgT120I GGNCC 1 cut(s) 134
BmiI GGNNCC 1 cut(s) 135
BmrFI CCNGG 5 cut(s) 144, 216, 276, 290, 291
BpmI CTGGAG 1 cut(s) 36
BpuEI CTTGAG 1 cut(s) 392
BpuMI CCSGG 2 cut(s) 290, 291
BsaJI CCNNGG 1 cut(s) 289
Bsc4I CCNNNNNNNGG 1 cut(s) 143
Bse1I ACTGG 2 cut(s) 14, 19
BseBI CCWGG 3 cut(s) 144, 216, 276
BseDI CCNNGG 1 cut(s) 289
BseLI CCNNNNNNNGG 1 cut(s) 143
BseNI ACTGG 2 cut(s) 14, 19
BseRI GAGGAG 1 cut(s) 255
BsiHKCI CYCGRG 1 cut(s) 289
BsiSI CCGG 1 cut(s) 290
BslI CCNNNNNNNGG 1 cut(s) 143
BsoBI CYCGRG 1 cut(s) 289
Bsp143I GATC 2 cut(s) 103, 205
BspLI GGNNCC 1 cut(s) 135
BspMAI CTGCAG 1 cut(s) 46
BsrI ACTGG 2 cut(s) 14, 19
BssECI CCNNGG 1 cut(s) 289
BssMI GATC 2 cut(s) 103, 205
Bst2UI CCWGG 3 cut(s) 144, 216, 276
Bst6I CTCTTC 1 cut(s) 144
BstENI CCTNNNNNAGG 1 cut(s) 141
BstKTI GATC 2 cut(s) 106, 208
BstMBI GATC 2 cut(s) 103, 205
BstMWI GCNNNNNNNGC 1 cut(s) 227
BstNI CCWGG 3 cut(s) 144, 216, 276
BstSCI CCNGG 5 cut(s) 142, 214, 274, 288, 289
BstSFI CTRYAG 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 134
Cfr9I CCCGGG 1 cut(s) 289
CviAII CATG 1 cut(s) 130
CviJI RGCY 2 cut(s) 97, 230
CviKI_1 RGCY 2 cut(s) 97, 230
DpnI GATC 2 cut(s) 105, 207
DpnII GATC 2 cut(s) 103, 205
Eam1104I CTCTTC 1 cut(s) 144
EarI CTCTTC 1 cut(s) 144
Eco47I GGWCC 1 cut(s) 134
Eco88I CYCGRG 1 cut(s) 289
EcoNI CCTNNNNNAGG 1 cut(s) 141
EcoO109I RGGNCCY 1 cut(s) 134
EcoRI GAATTC 1 cut(s) 84
EcoRII CCWGG 3 cut(s) 142, 214, 274
FaeI CATG 1 cut(s) 133
FaiI YATR 7 cut(s) 63, 78, 124, 131, 240, 253, 255
FatI CATG 1 cut(s) 129
FbaI TGATCA 1 cut(s) 205
FblI GTMKAC 2 cut(s) 6, 48
GsuI CTGGAG 1 cut(s) 36
HapII CCGG 1 cut(s) 290
Hin1II CATG 1 cut(s) 133
HinfI GANTC 3 cut(s) 38, 285, 383
HpaII CCGG 1 cut(s) 290
HphI GGTGA 1 cut(s) 254
Hpy166II GTNNAC 2 cut(s) 7, 49
Hpy188I TCNGA 2 cut(s) 201, 395
Hpy188III TCNNGA 1 cut(s) 340
Hpy8I GTNNAC 2 cut(s) 7, 49
HpyAV CCTTC 1 cut(s) 239
HpyCH4IV ACGT 1 cut(s) 51
HpyCH4V TGCA 3 cut(s) 44, 126, 221
HpyF10VI GCNNNNNNNGC 1 cut(s) 227
HpySE526I ACGT 1 cut(s) 51
Hsp92II CATG 1 cut(s) 133
Ksp22I TGATCA 1 cut(s) 205
Kzo9I GATC 2 cut(s) 103, 205
MaeII ACGT 1 cut(s) 51
MalI GATC 2 cut(s) 105, 207
MboI GATC 2 cut(s) 103, 205
MboII GAAGA 2 cut(s) 98, 131
MluCI AATT 1 cut(s) 84
MlyI GAGTC 2 cut(s) 32, 392
MmeI TCCRAC 1 cut(s) 295
MnlI CCTC 6 cut(s) 11, 78, 147, 182, 276, 351
MseI TTAA 2 cut(s) 27, 296
MspI CCGG 1 cut(s) 290
MspR9I CCNGG 5 cut(s) 144, 216, 276, 290, 291
MvaI CCWGG 3 cut(s) 144, 216, 276
MwoI GCNNNNNNNGC 1 cut(s) 227
NciI CCSGG 2 cut(s) 290, 291
NdeII GATC 2 cut(s) 103, 205
NlaIII CATG 1 cut(s) 133
NlaIV GGNNCC 1 cut(s) 135
PfeI GAWTC 1 cut(s) 285
PfoI TCCNGGA 1 cut(s) 142
PleI GAGTC 2 cut(s) 32, 391
PpsI GAGTC 2 cut(s) 32, 391
PpuMI RGGWCCY 1 cut(s) 134
Psp5II RGGWCCY 1 cut(s) 134
Psp6I CCWGG 3 cut(s) 142, 214, 274
PspGI CCWGG 3 cut(s) 142, 214, 274
PspN4I GGNNCC 1 cut(s) 135
PspPI GGNCC 1 cut(s) 134
PspPPI RGGWCCY 1 cut(s) 134
PstI CTGCAG 1 cut(s) 46
SaqAI TTAA 2 cut(s) 27, 296
Sau3AI GATC 2 cut(s) 103, 205
Sau96I GGNCC 1 cut(s) 134
SchI GAGTC 2 cut(s) 32, 392
ScrFI CCNGG 5 cut(s) 144, 216, 276, 290, 291
SetI ASST 4 cut(s) 22, 54, 70, 232
SfcI CTRYAG 1 cut(s) 42
SinI GGWCC 1 cut(s) 134
SmaI CCCGGG 1 cut(s) 291
SmlI CTYRAG 1 cut(s) 371
SmoI CTYRAG 1 cut(s) 371
Sse9I AATT 1 cut(s) 84
StyD4I CCNGG 5 cut(s) 142, 214, 274, 288, 289
TaiI ACGT 1 cut(s) 54
TaqI TCGA 1 cut(s) 174
TasI AATT 1 cut(s) 84
TfiI GAWTC 1 cut(s) 285
Tru1I TTAA 2 cut(s) 27, 296
Tru9I TTAA 2 cut(s) 27, 296
TspDTI ATGAA 1 cut(s) 165
TspMI CCCGGG 1 cut(s) 289
VpaK11BI GGWCC 1 cut(s) 134
XagI CCTNNNNNAGG 1 cut(s) 141
XapI RAATTY 1 cut(s) 84
XcmI CCANNNNNNNNNTGG 1 cut(s) 150
XmaI CCCGGG 1 cut(s) 289
XmiI GTMKAC 2 cut(s) 6, 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.