Rh2DG412200

Chromatin structure-remodeling complex protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Forward (+)
59787846 .. 59789256
1411 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG412200.1

Sequence Viewer

Length: 219 bp
ATGGATGTAAGCCATGCTCCCAAAGGATATGTCAAGAAGTTCAGAATGCCAACTTCCCATAATTTAATCCCAATTCGGGTCGATTTTGAAGTCAAAGGCCAGAGGTTCAAAGACTCCTTCACTTGGAACCCATCTGGTGGAGAGATTTGCGAAGGAAGAGGATCAAGGTTTCTAGATATCAAAGAGGATGAGTCTGAGGATGATGACATTGATGGATAA

Protein Analysis

72

Amino Acids

8.23

Weight (kDa)

5.01

Isoelectric Point (pI)

30.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
SNF5 PF04855 19 - 43 1.5e-06 SNF5 / SMARCB1 / INI1
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 137
AclWI GGATC 1 cut(s) 169
AfiI CCNNNNNNNGG 3 cut(s) 76, 123, 137
AgsI TTSAA 2 cut(s) 89, 109
AlwI GGATC 1 cut(s) 169
AoxI GGCC 1 cut(s) 97
ArsI GACNNNNNNTTYG 2 cut(s) 15, 47
BccI CCATC 2 cut(s) 139, 206
BfaI CTAG 1 cut(s) 173
BmiI GGNNCC 1 cut(s) 128
Bsc4I CCNNNNNNNGG 3 cut(s) 76, 123, 137
BseGI GGATG 3 cut(s) 10, 193, 205
BseLI CCNNNNNNNGG 3 cut(s) 76, 123, 137
BseMII CTCAG 1 cut(s) 186
BshFI GGCC 1 cut(s) 99
BslI CCNNNNNNNGG 3 cut(s) 76, 123, 137
BsmI GAATGC 1 cut(s) 51
BsnI GGCC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 161
BspANI GGCC 1 cut(s) 99
BspCNI CTCAG 1 cut(s) 187
BspLI GGNNCC 1 cut(s) 128
BspPI GGATC 1 cut(s) 169
BssMI GATC 1 cut(s) 161
Bst6I CTCTTC 1 cut(s) 151
BstDEI CTNAG 1 cut(s) 195
BstF5I GGATG 3 cut(s) 10, 193, 205
BstKTI GATC 1 cut(s) 164
BstMBI GATC 1 cut(s) 161
BsuRI GGCC 1 cut(s) 99
BtsCI GGATG 3 cut(s) 10, 193, 205
CviAII CATG 1 cut(s) 14
CviJI RGCY 2 cut(s) 12, 99
CviKI_1 RGCY 2 cut(s) 12, 99
DdeI CTNAG 1 cut(s) 195
DpnI GATC 1 cut(s) 163
DpnII GATC 1 cut(s) 161
Eam1104I CTCTTC 1 cut(s) 151
EarI CTCTTC 1 cut(s) 151
Eco32I GATATC 1 cut(s) 178
EcoRV GATATC 1 cut(s) 178
FaeI CATG 1 cut(s) 17
FaiI YATR 3 cut(s) 15, 30, 60
FatI CATG 1 cut(s) 13
FokI GGATG 3 cut(s) 17, 200, 212
FspBI CTAG 1 cut(s) 173
HaeIII GGCC 1 cut(s) 99
Hin1II CATG 1 cut(s) 17
HinfI GANTC 2 cut(s) 113, 191
Hpy188I TCNGA 2 cut(s) 44, 196
Hpy188III TCNNGA 2 cut(s) 34, 173
HpyAV CCTTC 2 cut(s) 127, 146
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 1 cut(s) 17
Kzo9I GATC 1 cut(s) 161
LmnI GCTCC 1 cut(s) 22
LpnPI CCDG 2 cut(s) 113, 120
MaeI CTAG 1 cut(s) 173
MalI GATC 1 cut(s) 163
MboI GATC 1 cut(s) 161
MboII GAAGA 1 cut(s) 168
MluCI AATT 2 cut(s) 61, 72
MlyI GAGTC 2 cut(s) 107, 200
MnlI CCTC 4 cut(s) 96, 152, 178, 190
MseI TTAA 1 cut(s) 65
Mva1269I GAATGC 1 cut(s) 51
NdeII GATC 1 cut(s) 161
NlaIII CATG 1 cut(s) 17
NlaIV GGNNCC 1 cut(s) 128
PctI GAATGC 1 cut(s) 51
PflMI CCANNNNNTGG 1 cut(s) 137
PleI GAGTC 2 cut(s) 107, 199
PpsI GAGTC 2 cut(s) 107, 199
PspN4I GGNNCC 1 cut(s) 128
SaqAI TTAA 1 cut(s) 65
Sau3AI GATC 1 cut(s) 161
SchI GAGTC 2 cut(s) 107, 200
SetI ASST 2 cut(s) 107, 170
SgeI CNNG 8 cut(s) 26, 46, 89, 112, 135, 147, 177, 185
Sse9I AATT 2 cut(s) 61, 72
SspMI CTAG 1 cut(s) 173
TaqI TCGA 1 cut(s) 81
TasI AATT 2 cut(s) 61, 72
Tru1I TTAA 1 cut(s) 65
Tru9I TTAA 1 cut(s) 65
Van91I CCANNNNNTGG 1 cut(s) 137
XbaI TCTAGA 1 cut(s) 172
XspI CTAG 1 cut(s) 173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.