Rh3BG062000

GPI-anchored protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
OG0005399
Physical Location & Seq
Forward (+)
4166921 .. 4168070
1150 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG062000.1

Sequence Viewer

Length: 588 bp
ATGGCCGTCTCAAAACTGAGCTTATTGTTTGCCTTTGTGCTTGTTCACGCCTTCCTCCTCCATTCTTCTCCAGTATATTGTAATGAAGAAGAAGACGATCTTTTCGAGGAACTCAACAGTTTCAGGGGATCCCTAAACCTTACAGCCTTCACAGAGAAAGAAAAGGCCGACTGTATAGCCGACGAAATCTCGGATGAGCTAGAGGATGAGCAATGCTCTAGAGCAGCTGAATACCAGATTAAACCAGGAAATGGTCCTCAGTTCCCCTCCTTCACCAAGTCCTTAACCAAGTGTGACATAGACAACAGCACCACAACTGGTGGGATCATTTTGCCAGTTTGTGTGCACAATTTGGACCCAGATCTGGTGCGTAAAAATTATACTGAAACCAAATTTGCTCAGTTTCTGAATGATTCCAAGTATACAGGAGCTGGGCTTGGTTCTAAGGATGATTGGATGATCGTTGTGTTGACCACTGACGCACATAGTGGGAGCTTTACTGGTGCTGCTGCTTCTTTGGTTGCAACTGGCATGGTTCACTACATGGTTGCTTTGTTGTTGGGATTGTTCTTGGTTTTTTCTCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

195

Amino Acids

21.33

Weight (kDa)

4.55

Isoelectric Point (pI)

31.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
At5g19230 PF25884 31 - 157 3.7e-50 Uncharacterized GPI-anchored protein At5g19230-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 251
AccI GTMKAC 1 cut(s) 422
AclWI GGATC 3 cut(s) 123, 136, 332
AcoI YGGCCR 1 cut(s) 3
AcsI RAATTY 1 cut(s) 392
AdeI CACNNNGTG 1 cut(s) 488
AfiI CCNNNNNNNGG 2 cut(s) 251, 364
AjnI CCWGG 1 cut(s) 244
AluBI AGCT 5 cut(s) 21, 199, 227, 431, 495
AluI AGCT 5 cut(s) 21, 199, 227, 431, 495
Alw21I GWGCWC 1 cut(s) 348
Alw26I GTCTC 1 cut(s) 13
Alw44I GTGCAC 1 cut(s) 344
AlwI GGATC 3 cut(s) 123, 136, 332
AlwNI CAGNNNCTG 2 cut(s) 406, 431
AoxI GGCC 2 cut(s) 3, 165
ApaLI GTGCAC 1 cut(s) 344
ApeKI GCWGC 3 cut(s) 224, 506, 509
ApoI RAATTY 1 cut(s) 392
ArsI GACNNNNNNTTYG 2 cut(s) 86, 118
AspS9I GGNCC 2 cut(s) 254, 355
AsuHPI GGTGA 1 cut(s) 265
AvaII GGWCC 2 cut(s) 254, 355
BaeGI GKGCMC 1 cut(s) 348
BamHI GGATCC 1 cut(s) 128
BbsI GAAGAC 1 cut(s) 99
Bbv12I GWGCWC 1 cut(s) 348
BbvI GCAGC 3 cut(s) 236, 493, 496
BciT130I CCWGG 1 cut(s) 246
BcoDI GTCTC 1 cut(s) 13
BfaI CTAG 2 cut(s) 200, 219
BglII AGATCT 1 cut(s) 361
BisI GCNGC 3 cut(s) 225, 507, 510
BlsI GCNGC 3 cut(s) 226, 508, 511
Bme1390I CCNGG 1 cut(s) 246
Bme18I GGWCC 2 cut(s) 254, 355
BmgT120I GGNCC 2 cut(s) 254, 355
BmiI GGNNCC 2 cut(s) 130, 357
BmrFI CCNGG 1 cut(s) 246
BpiI GAAGAC 1 cut(s) 99
BplI GAGNNNNNCTC 2 cut(s) 200, 232
BpmI CTGGAG 1 cut(s) 54
Bsc4I CCNNNNNNNGG 2 cut(s) 251, 364
Bse1I ACTGG 5 cut(s) 71, 322, 335, 505, 532
Bse3DI GCAATG 1 cut(s) 218
BseBI CCWGG 1 cut(s) 246
BseGI GGATG 4 cut(s) 199, 211, 454, 462
BseLI CCNNNNNNNGG 2 cut(s) 251, 364
BseMI GCAATG 1 cut(s) 218
BseMII CTCAG 3 cut(s) 8, 272, 413
BseNI ACTGG 5 cut(s) 71, 322, 335, 505, 532
BseRI GAGGAG 1 cut(s) 47
BseSI GKGCMC 1 cut(s) 348
BseXI GCAGC 3 cut(s) 236, 493, 496
BseYI CCCAGC 1 cut(s) 431
BshFI GGCC 2 cut(s) 5, 167
BsiHKAI GWGCWC 1 cut(s) 348
BslI CCNNNNNNNGG 2 cut(s) 251, 364
BsmAI GTCTC 1 cut(s) 13
BsmBI CGTCTC 1 cut(s) 13
BsnI GGCC 2 cut(s) 5, 167
Bsp1286I GDGCHC 1 cut(s) 348
Bsp143I GATC 5 cut(s) 97, 128, 324, 361, 459
BspANI GGCC 2 cut(s) 5, 167
BspCNI CTCAG 3 cut(s) 9, 271, 412
BspLI GGNNCC 2 cut(s) 130, 357
BspPI GGATC 3 cut(s) 123, 136, 332
BsrDI GCAATG 1 cut(s) 218
BsrI ACTGG 5 cut(s) 71, 322, 335, 505, 532
BssMI GATC 5 cut(s) 97, 128, 324, 361, 459
BssNAI GTATAC 1 cut(s) 423
Bst1107I GTATAC 1 cut(s) 423
Bst2UI CCWGG 1 cut(s) 246
Bst4CI ACNGT 2 cut(s) 119, 173
BstDEI CTNAG 4 cut(s) 17, 258, 399, 444
BstF5I GGATG 4 cut(s) 199, 211, 454, 462
BstKTI GATC 5 cut(s) 100, 131, 327, 364, 462
BstMAI GTCTC 1 cut(s) 13
BstMBI GATC 5 cut(s) 97, 128, 324, 361, 459
BstNI CCWGG 1 cut(s) 246
BstSCI CCNGG 1 cut(s) 244
BstSLI GKGCMC 1 cut(s) 348
BstV1I GCAGC 3 cut(s) 236, 493, 496
BstV2I GAAGAC 1 cut(s) 99
BstX2I RGATCY 2 cut(s) 128, 361
BstYI RGATCY 2 cut(s) 128, 361
BstZ17I GTATAC 1 cut(s) 423
BsuRI GGCC 2 cut(s) 5, 167
BtsCI GGATG 4 cut(s) 199, 211, 454, 462
BtsIMutI CAGTG 1 cut(s) 474
CaiI CAGNNNCTG 2 cut(s) 406, 431
Cfr13I GGNCC 2 cut(s) 254, 355
CseI GACGC 1 cut(s) 488
CviAII CATG 2 cut(s) 532, 544
DdeI CTNAG 4 cut(s) 17, 258, 399, 444
DpnI GATC 5 cut(s) 99, 130, 326, 363, 461
DpnII GATC 5 cut(s) 97, 128, 324, 361, 459
DraIII CACNNNGTG 1 cut(s) 488
EaeI YGGCCR 1 cut(s) 3
Eco47I GGWCC 2 cut(s) 254, 355
EcoRII CCWGG 1 cut(s) 244
Esp3I CGTCTC 1 cut(s) 13
FaeI CATG 2 cut(s) 535, 547
FaiI YATR 8 cut(s) 76, 176, 299, 381, 423, 486, 533, 545
FalI AAGNNNNNCTT 2 cut(s) 84, 116
FatI CATG 2 cut(s) 531, 543
FblI GTMKAC 1 cut(s) 422
Fnu4HI GCNGC 3 cut(s) 225, 507, 510
FokI GGATG 4 cut(s) 206, 218, 461, 469
Fsp4HI GCNGC 3 cut(s) 225, 507, 510
FspBI CTAG 2 cut(s) 200, 219
GluI GCNGC 3 cut(s) 225, 507, 510
GsaI CCCAGC 1 cut(s) 435
GsuI CTGGAG 1 cut(s) 54
HaeIII GGCC 2 cut(s) 5, 167
HgaI GACGC 1 cut(s) 488
Hin1II CATG 2 cut(s) 535, 547
HincII GTYRAC 1 cut(s) 471
HindII GTYRAC 1 cut(s) 471
HinfI GANTC 1 cut(s) 413
HphI GGTGA 1 cut(s) 265
Hpy166II GTNNAC 5 cut(s) 46, 346, 423, 471, 538
Hpy188I TCNGA 2 cut(s) 193, 408
Hpy188III TCNNGA 1 cut(s) 219
Hpy8I GTNNAC 5 cut(s) 46, 346, 423, 471, 538
Hpy99I CGWCG 1 cut(s) 185
HpyAV CCTTC 3 cut(s) 61, 157, 280
HpyCH4III ACNGT 2 cut(s) 119, 173
HpyCH4V TGCA 2 cut(s) 346, 524
HpyF3I CTNAG 4 cut(s) 17, 258, 399, 444
Hsp92II CATG 2 cut(s) 535, 547
Kzo9I GATC 5 cut(s) 97, 128, 324, 361, 459
LmnI GCTCC 2 cut(s) 428, 492
Lsp1109I GCAGC 3 cut(s) 236, 493, 496
MaeI CTAG 2 cut(s) 200, 219
MaeIII GTNAC 1 cut(s) 293
MalI GATC 5 cut(s) 99, 130, 326, 363, 461
MboI GATC 5 cut(s) 97, 128, 324, 361, 459
MboII GAAGA 4 cut(s) 57, 98, 101, 104
MflI RGATCY 2 cut(s) 128, 361
MhlI GDGCHC 1 cut(s) 348
MluCI AATT 3 cut(s) 349, 376, 392
MnlI CCTC 6 cut(s) 65, 68, 100, 196, 267, 277
MseI TTAA 3 cut(s) 240, 284, 586
MspA1I CMGCKG 1 cut(s) 227
MspR9I CCNGG 1 cut(s) 246
MvaI CCWGG 1 cut(s) 246
NdeII GATC 5 cut(s) 97, 128, 324, 361, 459
NlaIII CATG 2 cut(s) 535, 547
NlaIV GGNNCC 2 cut(s) 130, 357
NmuCI GTSAC 1 cut(s) 293
PcsI WCGNNNNNNNCGW 1 cut(s) 102
PfeI GAWTC 1 cut(s) 413
PflMI CCANNNNNTGG 1 cut(s) 251
PkrI GCNGC 3 cut(s) 226, 508, 511
Psp6I CCWGG 1 cut(s) 244
PspFI CCCAGC 1 cut(s) 431
PspGI CCWGG 1 cut(s) 244
PspN4I GGNNCC 2 cut(s) 130, 357
PspPI GGNCC 2 cut(s) 254, 355
PstNI CAGNNNCTG 2 cut(s) 406, 431
PsuI RGATCY 2 cut(s) 128, 361
PvuII CAGCTG 1 cut(s) 227
SaqAI TTAA 3 cut(s) 240, 284, 586
SatI GCNGC 3 cut(s) 225, 507, 510
Sau3AI GATC 5 cut(s) 97, 128, 324, 361, 459
Sau96I GGNCC 2 cut(s) 254, 355
ScrFI CCNGG 1 cut(s) 246
SduI GDGCHC 1 cut(s) 348
SetI ASST 6 cut(s) 23, 141, 201, 229, 433, 497
SinI GGWCC 2 cut(s) 254, 355
Sse9I AATT 3 cut(s) 349, 376, 392
SspMI CTAG 2 cut(s) 200, 219
StyD4I CCNGG 1 cut(s) 244
TaaI ACNGT 2 cut(s) 119, 173
TaqI TCGA 1 cut(s) 105
TasI AATT 3 cut(s) 349, 376, 392
TfiI GAWTC 1 cut(s) 413
Tru1I TTAA 3 cut(s) 240, 284, 586
Tru9I TTAA 3 cut(s) 240, 284, 586
TscAI CASTG 1 cut(s) 481
TseFI GTSAC 1 cut(s) 293
TseI GCWGC 3 cut(s) 224, 506, 509
Tsp45I GTSAC 1 cut(s) 293
TspDTI ATGAA 1 cut(s) 99
TspRI CASTG 1 cut(s) 481
Van91I CCANNNNNTGG 1 cut(s) 251
VneI GTGCAC 1 cut(s) 344
VpaK11BI GGWCC 2 cut(s) 254, 355
XapI RAATTY 1 cut(s) 392
XbaI TCTAGA 1 cut(s) 218
XmiI GTMKAC 1 cut(s) 422
XspI CTAG 2 cut(s) 200, 219
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.