Rh3BG146400

Belongs to the cyclin family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3B
Physical Location & Seq
Forward (+)
12456927 .. 12457379
453 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3BG146400.1

Sequence Viewer

Length: 366 bp
ATGGATCAAAGTTTGCTCTGCGATGAGGTGTGGCCTTCCAGCCCTTTGACGACTGCTATGAACTACATGATTGATTGTGGAACATTATCAATGTATGCAAGAAGTAAGGATGACTATGATGAATCTTTTACTATATGCTTGGAGAAGGAGATGAGTTACATGCCCCAACCGAACTACGTAGAAAATCTCTGCTCAAATCATTTGGTCATTGCTAGGTTTAAAAGCATTCAATGGTTTATCAAGTCTAGAAGCCGCTTGAACCTCTCCCTTAGAACTGTTTTTTATGCTGCAAACTACCTTGATCGCTTCATATCTATGAATCACTGTAATGTAAGCAATATGATATACCTGTATATATGTGTGTGA

Protein Analysis

121

Amino Acids

14.23

Weight (kDa)

5.56

Isoelectric Point (pI)

61.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Cyclin_N PF00134 43 - 113 1.4e-07 Cyclin, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 253
AclWI GGATC 1 cut(s) 12
AgsI TTSAA 2 cut(s) 230, 259
AlwI GGATC 1 cut(s) 12
AoxI GGCC 1 cut(s) 32
ApeKI GCWGC 1 cut(s) 287
BbvI GCAGC 1 cut(s) 274
BfaI CTAG 2 cut(s) 213, 246
BisI GCNGC 2 cut(s) 253, 288
BlsI GCNGC 2 cut(s) 254, 289
BsaAI YACGTR 1 cut(s) 178
Bse3DI GCAATG 1 cut(s) 207
BseGI GGATG 1 cut(s) 115
BseMI GCAATG 1 cut(s) 207
BseXI GCAGC 1 cut(s) 274
BshFI GGCC 1 cut(s) 34
BsmI GAATGC 1 cut(s) 225
BsnI GGCC 1 cut(s) 34
Bsp143I GATC 2 cut(s) 4, 301
BspACI CCGC 1 cut(s) 253
BspANI GGCC 1 cut(s) 34
BspPI GGATC 1 cut(s) 12
BsrDI GCAATG 1 cut(s) 207
BssMI GATC 2 cut(s) 4, 301
Bst4CI ACNGT 2 cut(s) 277, 326
BstBAI YACGTR 1 cut(s) 178
BstDEI CTNAG 1 cut(s) 269
BstF5I GGATG 1 cut(s) 115
BstKTI GATC 2 cut(s) 7, 304
BstMBI GATC 2 cut(s) 4, 301
BstNSI RCATGY 1 cut(s) 163
BstSNI TACGTA 1 cut(s) 178
BstV1I GCAGC 1 cut(s) 274
BsuRI GGCC 1 cut(s) 34
BtgZI GCGATG 1 cut(s) 36
BtsCI GGATG 1 cut(s) 115
BtsIMutI CAGTG 1 cut(s) 322
CviAII CATG 2 cut(s) 67, 160
CviJI RGCY 3 cut(s) 34, 42, 252
CviKI_1 RGCY 3 cut(s) 34, 42, 252
DdeI CTNAG 1 cut(s) 269
DpnI GATC 2 cut(s) 6, 303
DpnII GATC 2 cut(s) 4, 301
DraI TTTAAA 1 cut(s) 220
Eco105I TACGTA 1 cut(s) 178
FaeI CATG 2 cut(s) 70, 163
FatI CATG 2 cut(s) 66, 159
Fnu4HI GCNGC 2 cut(s) 253, 288
FokI GGATG 1 cut(s) 122
Fsp4HI GCNGC 2 cut(s) 253, 288
FspBI CTAG 2 cut(s) 213, 246
GluI GCNGC 2 cut(s) 253, 288
HaeIII GGCC 1 cut(s) 34
Hin1II CATG 2 cut(s) 70, 163
HinfI GANTC 2 cut(s) 122, 319
Hpy188III TCNNGA 1 cut(s) 246
HpyAV CCTTC 2 cut(s) 45, 139
HpyCH4III ACNGT 2 cut(s) 277, 326
HpyCH4IV ACGT 1 cut(s) 177
HpyCH4V TGCA 2 cut(s) 98, 290
HpyF3I CTNAG 1 cut(s) 269
HpySE526I ACGT 1 cut(s) 177
Hsp92II CATG 2 cut(s) 70, 163
Kzo9I GATC 2 cut(s) 4, 301
LpnPI CCDG 2 cut(s) 52, 362
Lsp1109I GCAGC 1 cut(s) 274
MaeI CTAG 2 cut(s) 213, 246
MaeII ACGT 1 cut(s) 177
MaeIII GTNAC 1 cut(s) 155
MalI GATC 2 cut(s) 6, 303
MboI GATC 2 cut(s) 4, 301
MnlI CCTC 2 cut(s) 19, 272
MseI TTAA 1 cut(s) 219
MslI CAYNNNNRTG 2 cut(s) 314, 327
Mva1269I GAATGC 1 cut(s) 225
NdeII GATC 2 cut(s) 4, 301
NlaIII CATG 2 cut(s) 70, 163
NspI RCATGY 1 cut(s) 163
PctI GAATGC 1 cut(s) 225
PfeI GAWTC 2 cut(s) 122, 319
PkrI GCNGC 2 cut(s) 254, 289
Ppu21I YACGTR 1 cut(s) 178
RseI CAYNNNNRTG 2 cut(s) 314, 327
SaqAI TTAA 1 cut(s) 219
SatI GCNGC 2 cut(s) 253, 288
Sau3AI GATC 2 cut(s) 4, 301
SetI ASST 6 cut(s) 30, 180, 218, 264, 300, 351
SmiMI CAYNNNNRTG 2 cut(s) 314, 327
SnaBI TACGTA 1 cut(s) 178
SsiI CCGC 1 cut(s) 253
SspMI CTAG 2 cut(s) 213, 246
TaaI ACNGT 2 cut(s) 277, 326
TaiI ACGT 1 cut(s) 180
TauI GCSGC 1 cut(s) 255
TfiI GAWTC 2 cut(s) 122, 319
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TscAI CASTG 1 cut(s) 329
TseI GCWGC 1 cut(s) 287
TspDTI ATGAA 4 cut(s) 74, 135, 298, 332
TspRI CASTG 1 cut(s) 329
XbaI TCTAGA 1 cut(s) 245
XceI RCATGY 1 cut(s) 163
XspI CTAG 2 cut(s) 213, 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.