Rh3DG253600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Reverse (-)
25049436 .. 25051775
2340 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG253600.1

Sequence Viewer

Length: 159 bp
ATGATGATGAACGACGAATCCTCTGATGACGAGGATGAAGCAATTATGCTTGTTCTTGTTGAACAATCAATGAAGGAAGACAAGTCCCGCCGCCGACGCGGTTCTGTTGAAGGTCACAGTACTGTCCCGTGTGATAGAATCGATGTTGAGAATCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

5.98

Weight (kDa)

4.39

Isoelectric Point (pI)

73.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 99
AciI CCGC 3 cut(s) 88, 91, 99
AfaI GTAC 1 cut(s) 121
AgsI TTSAA 2 cut(s) 62, 110
AloI GAACNNNNNNTCC 1 cut(s) 34
BbsI GAAGAC 1 cut(s) 84
BisI GCNGC 1 cut(s) 91
BlsI GCNGC 1 cut(s) 92
BmcAI AGTACT 1 cut(s) 121
BpiI GAAGAC 1 cut(s) 84
Bsa29I ATCGAT 1 cut(s) 141
BseCI ATCGAT 1 cut(s) 141
BseGI GGATG 1 cut(s) 40
Bsh1236I CGCG 1 cut(s) 99
BshVI ATCGAT 1 cut(s) 141
BslFI GGGAC 2 cut(s) 70, 110
BsmFI GGGAC 2 cut(s) 70, 110
BspACI CCGC 3 cut(s) 88, 91, 99
BspDI ATCGAT 1 cut(s) 141
BspFNI CGCG 1 cut(s) 99
Bst4CI ACNGT 2 cut(s) 119, 124
BstF5I GGATG 1 cut(s) 40
BstFNI CGCG 1 cut(s) 99
BstMWI GCNNNNNNNGC 1 cut(s) 96
BstUI CGCG 1 cut(s) 99
BstV2I GAAGAC 1 cut(s) 84
Bsu15I ATCGAT 1 cut(s) 141
BsuTUI ATCGAT 1 cut(s) 141
BtsCI GGATG 1 cut(s) 40
ClaI ATCGAT 1 cut(s) 141
CseI GACGC 1 cut(s) 105
Csp6I GTAC 1 cut(s) 120
CviQI GTAC 1 cut(s) 120
FaiI YATR 2 cut(s) 47, 157
FaqI GGGAC 2 cut(s) 70, 110
FauI CCCGC 1 cut(s) 95
Fnu4HI GCNGC 1 cut(s) 91
FokI GGATG 1 cut(s) 47
Fsp4HI GCNGC 1 cut(s) 91
GluI GCNGC 1 cut(s) 91
HgaI GACGC 1 cut(s) 105
HinfI GANTC 3 cut(s) 17, 138, 151
Hpy188I TCNGA 1 cut(s) 25
Hpy99I CGWCG 2 cut(s) 17, 99
HpyAV CCTTC 2 cut(s) 67, 104
HpyCH4III ACNGT 2 cut(s) 119, 124
HpyF10VI GCNNNNNNNGC 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 113
MboII GAAGA 1 cut(s) 89
MluCI AATT 1 cut(s) 42
MnlI CCTC 2 cut(s) 25, 31
MvnI CGCG 1 cut(s) 99
MwoI GCNNNNNNNGC 1 cut(s) 96
NmuCI GTSAC 1 cut(s) 113
PfeI GAWTC 3 cut(s) 17, 138, 151
PkrI GCNGC 1 cut(s) 92
RsaI GTAC 1 cut(s) 121
RsaNI GTAC 1 cut(s) 120
SatI GCNGC 1 cut(s) 91
ScaI AGTACT 1 cut(s) 121
SetI ASST 1 cut(s) 115
SgeI CNNG 8 cut(s) 43, 62, 68, 94, 99, 110, 139, 141
Sse9I AATT 1 cut(s) 42
SsiI CCGC 3 cut(s) 88, 91, 99
TaaI ACNGT 2 cut(s) 119, 124
TaqI TCGA 1 cut(s) 141
TasI AATT 1 cut(s) 42
TatI WGTACW 1 cut(s) 119
TauI GCSGC 1 cut(s) 93
TfiI GAWTC 3 cut(s) 17, 138, 151
TseFI GTSAC 1 cut(s) 113
Tsp45I GTSAC 1 cut(s) 113
TspDTI ATGAA 3 cut(s) 23, 51, 86
ZrmI AGTACT 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.