Rh4AG105300

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
22627050 .. 22629552
2503 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG105300.1

Sequence Viewer

Length: 180 bp
ATGGTGAGTGTGATGATCGTCATGCATGACGAGCGTACTCAGAGTAGACCACTGCAATTCAAAATGCACTATTCTGCTCAGAGGTCAGCTTCTCACATCCTCAAGATGATGGAGAAGGACAAAATTAAGATGGATGATGAGACTTCTGCTCTTGTCCACGCTTTCAATGTCTGTGAATAA

Protein Analysis

59

Amino Acids

6.91

Weight (kDa)

6.9

Isoelectric Point (pI)

78.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 46
AfaI GTAC 1 cut(s) 37
AgsI TTSAA 2 cut(s) 61, 166
AluBI AGCT 1 cut(s) 89
AluI AGCT 1 cut(s) 89
Alw26I GTCTC 1 cut(s) 134
AsuHPI GGTGA 1 cut(s) 16
BccI CCATC 2 cut(s) 103, 124
BcoDI GTCTC 1 cut(s) 134
BpuEI CTTGAG 1 cut(s) 86
BseGI GGATG 2 cut(s) 96, 139
BseMII CTCAG 2 cut(s) 53, 92
BsmAI GTCTC 1 cut(s) 134
Bsp143I GATC 1 cut(s) 15
BspCNI CTCAG 2 cut(s) 52, 91
BssMI GATC 1 cut(s) 15
BstDEI CTNAG 2 cut(s) 39, 78
BstF5I GGATG 2 cut(s) 96, 139
BstKTI GATC 1 cut(s) 18
BstMAI GTCTC 1 cut(s) 134
BstMBI GATC 1 cut(s) 15
BstMWI GCNNNNNNNGC 1 cut(s) 31
BtsCI GGATG 2 cut(s) 96, 139
BtsI GCAGTG 1 cut(s) 50
BtsIMutI CAGTG 1 cut(s) 50
Csp6I GTAC 1 cut(s) 36
CviAII CATG 2 cut(s) 22, 26
CviJI RGCY 1 cut(s) 89
CviKI_1 RGCY 1 cut(s) 89
CviQI GTAC 1 cut(s) 36
DdeI CTNAG 2 cut(s) 39, 78
DpnI GATC 1 cut(s) 17
DpnII GATC 1 cut(s) 15
EcoT22I ATGCAT 1 cut(s) 27
FaeI CATG 2 cut(s) 25, 29
FaiI YATR 2 cut(s) 23, 27
FatI CATG 2 cut(s) 21, 25
FblI GTMKAC 1 cut(s) 46
FokI GGATG 2 cut(s) 83, 146
FspEI CC 7 cut(s) 63, 67, 95, 101, 113, 116, 170
Hin1II CATG 2 cut(s) 25, 29
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 2 cut(s) 47, 157
Hpy188I TCNGA 2 cut(s) 42, 81
Hpy188III TCNNGA 1 cut(s) 103
Hpy8I GTNNAC 2 cut(s) 47, 157
HpyAV CCTTC 1 cut(s) 109
HpyCH4V TGCA 3 cut(s) 25, 55, 67
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
HpyF3I CTNAG 2 cut(s) 39, 78
Hsp92II CATG 2 cut(s) 25, 29
Kzo9I GATC 1 cut(s) 15
MalI GATC 1 cut(s) 17
MboI GATC 1 cut(s) 15
MluCI AATT 2 cut(s) 56, 123
MnlI CCTC 2 cut(s) 75, 110
Mph1103I ATGCAT 1 cut(s) 27
MseI TTAA 1 cut(s) 126
MwoI GCNNNNNNNGC 1 cut(s) 31
NdeII GATC 1 cut(s) 15
NlaIII CATG 2 cut(s) 25, 29
NsiI ATGCAT 1 cut(s) 27
RsaI GTAC 1 cut(s) 37
RsaNI GTAC 1 cut(s) 36
SaqAI TTAA 1 cut(s) 126
Sau3AI GATC 1 cut(s) 15
SetI ASST 2 cut(s) 86, 91
SgeI CNNG 6 cut(s) 34, 38, 43, 115, 164, 170
SmlI CTYRAG 1 cut(s) 101
SmoI CTYRAG 1 cut(s) 101
Sse9I AATT 2 cut(s) 56, 123
TasI AATT 2 cut(s) 56, 123
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 1 cut(s) 57
TspRI CASTG 1 cut(s) 57
XmiI GTMKAC 1 cut(s) 46
Zsp2I ATGCAT 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.