Rh4AG110500

Catalyzes the radical-mediated insertion of two sulfur atoms into the C-6 and C-8 positions of the octanoyl moiety bound to the lipoyl domains of lipoate-dependent enzymes, thereby converting the octanoylated domains into lipoylated derivatives

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
23886252 .. 23886592
341 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG110500.1

Sequence Viewer

Length: 261 bp
ATGCAGATTAAGAAAAAGCTCAGGGAATCGAAGCTCCACACAGTCTGCGAGGAGGCCAAGTATCCCATTCTCAGCGAGTGCTGGTCCAGCGGTGAAACCGCCACCGCCACTATCATGATTCTGGGCAACATATGTACGCTCAATTGCAGGTTTTGTAATGTGAAGACTTCTAGGACTCCGCCGTGGCTGGACCCCAATGAGCCAGCGAATGTGGCGGAGGCGATTGCGTCGTGGGGGTTGGATTATGTGGCGATTACTTGA

Protein Analysis

86

Amino Acids

9.57

Weight (kDa)

6.54

Isoelectric Point (pI)

46.91

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Radical_SAM PF04055 39 - 86 1.7e-07 Radical SAM superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 138
AciI CCGC 5 cut(s) 90, 99, 105, 179, 215
AfaI GTAC 1 cut(s) 136
AluBI AGCT 2 cut(s) 19, 34
AluI AGCT 2 cut(s) 19, 34
AoxI GGCC 1 cut(s) 54
AspS9I GGNCC 2 cut(s) 84, 190
AsuHPI GGTGA 1 cut(s) 104
AvaII GGWCC 2 cut(s) 84, 190
BbsI GAAGAC 1 cut(s) 170
BceAI ACGGC 1 cut(s) 166
BciVI GTATCC 1 cut(s) 72
BfaI CTAG 1 cut(s) 171
BfuAI ACCTGC 1 cut(s) 138
BfuI GTATCC 1 cut(s) 72
Bme18I GGWCC 2 cut(s) 84, 190
BmgT120I GGNCC 2 cut(s) 84, 190
BmiI GGNNCC 1 cut(s) 192
BpiI GAAGAC 1 cut(s) 170
Bpu10I CCTNAGC 1 cut(s) 20
BsaJI CCNNGG 1 cut(s) 182
BsaXI ACNNNNNCTCC 2 cut(s) 44, 74
BseDI CCNNGG 1 cut(s) 182
BseMII CTCAG 2 cut(s) 34, 85
BseRI GAGGAG 1 cut(s) 65
BshFI GGCC 1 cut(s) 56
BsnI GGCC 1 cut(s) 56
BspACI CCGC 5 cut(s) 90, 99, 105, 179, 215
BspANI GGCC 1 cut(s) 56
BspCNI CTCAG 2 cut(s) 33, 84
BspHI TCATGA 1 cut(s) 114
BspLI GGNNCC 1 cut(s) 192
BspMI ACCTGC 1 cut(s) 138
BssECI CCNNGG 1 cut(s) 182
Bst4CI ACNGT 1 cut(s) 43
BstC8I GCNNGC 1 cut(s) 204
BstDEI CTNAG 2 cut(s) 20, 71
BstDSI CCRYGG 1 cut(s) 182
BstMWI GCNNNNNNNGC 2 cut(s) 87, 212
BstV2I GAAGAC 1 cut(s) 170
BsuI GTATCC 1 cut(s) 72
BsuRI GGCC 1 cut(s) 56
BtgI CCRYGG 1 cut(s) 182
BveI ACCTGC 1 cut(s) 138
Cac8I GCNNGC 1 cut(s) 204
CciI TCATGA 1 cut(s) 114
Cfr13I GGNCC 2 cut(s) 84, 190
CseI GACGC 1 cut(s) 216
Csp6I GTAC 1 cut(s) 135
CviAII CATG 1 cut(s) 115
CviJI RGCY 5 cut(s) 19, 34, 56, 187, 202
CviKI_1 RGCY 5 cut(s) 19, 34, 56, 187, 202
CviQI GTAC 1 cut(s) 135
DdeI CTNAG 2 cut(s) 20, 71
EciI GGCGGA 2 cut(s) 168, 230
Eco47I GGWCC 2 cut(s) 84, 190
FaeI CATG 1 cut(s) 118
FaiI YATR 4 cut(s) 116, 131, 133, 246
FatI CATG 1 cut(s) 114
FauNDI CATATG 1 cut(s) 131
FspBI CTAG 1 cut(s) 171
HaeIII GGCC 1 cut(s) 56
HgaI GACGC 1 cut(s) 216
Hin1II CATG 1 cut(s) 118
HinfI GANTC 3 cut(s) 26, 118, 175
HphI GGTGA 1 cut(s) 104
Hpy188III TCNNGA 1 cut(s) 115
Hpy99I CGWCG 1 cut(s) 232
HpyCH4III ACNGT 1 cut(s) 43
HpyCH4V TGCA 2 cut(s) 4, 147
HpyF10VI GCNNNNNNNGC 2 cut(s) 87, 212
HpyF3I CTNAG 2 cut(s) 20, 71
Hsp92II CATG 1 cut(s) 118
LmnI GCTCC 1 cut(s) 39
LpnPI CCDG 7 cut(s) 7, 67, 100, 107, 133, 173, 216
MaeI CTAG 1 cut(s) 171
MboII GAAGA 1 cut(s) 175
MfeI CAATTG 1 cut(s) 142
MluCI AATT 1 cut(s) 142
MlyI GAGTC 1 cut(s) 169
MmeI TCCRAC 1 cut(s) 219
MnlI CCTC 3 cut(s) 43, 46, 211
MseI TTAA 1 cut(s) 9
MslI CAYNNNNRTG 1 cut(s) 113
MspA1I CMGCKG 1 cut(s) 90
MunI CAATTG 1 cut(s) 142
MwoI GCNNNNNNNGC 2 cut(s) 87, 212
NdeI CATATG 1 cut(s) 131
NlaIII CATG 1 cut(s) 118
NlaIV GGNNCC 1 cut(s) 192
PagI TCATGA 1 cut(s) 114
PfeI GAWTC 2 cut(s) 26, 118
PleI GAGTC 1 cut(s) 169
PpsI GAGTC 1 cut(s) 169
PspN4I GGNNCC 1 cut(s) 192
PspPI GGNCC 2 cut(s) 84, 190
RsaI GTAC 1 cut(s) 136
RsaNI GTAC 1 cut(s) 135
RseI CAYNNNNRTG 1 cut(s) 113
SaqAI TTAA 1 cut(s) 9
Sau96I GGNCC 2 cut(s) 84, 190
SchI GAGTC 1 cut(s) 169
SetI ASST 3 cut(s) 21, 36, 152
SinI GGWCC 2 cut(s) 84, 190
SmiMI CAYNNNNRTG 1 cut(s) 113
Sse9I AATT 1 cut(s) 142
SsiI CCGC 5 cut(s) 90, 99, 105, 179, 215
SspMI CTAG 1 cut(s) 171
TaaI ACNGT 1 cut(s) 43
TaqI TCGA 1 cut(s) 29
TasI AATT 1 cut(s) 142
TfiI GAWTC 2 cut(s) 26, 118
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
VpaK11BI GGWCC 2 cut(s) 84, 190
XspI CTAG 1 cut(s) 171
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.