Rh4AG324600

Remorin, C-terminal region

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
OG0006512
Physical Location & Seq
Reverse (-)
63631550 .. 63631931
382 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG324600.1

Sequence Viewer

Length: 294 bp
ATGCATGATCACATGAATGGGAGGCCGAGTTCTAGTGCAGCAACTCGGCGATTATCAAACAAAGGAGCAAATAATGGTGGTGGAGCTTCAATGAAAAGGCCAATGGGGCAGGACCAAAAAACATTGGACTTAGAGAAAGCTTTTCCGTCCAGGTATCCAAATCGTGGAAACTCTATAAGGCCTCCAACTCCTGCAGACGGAAATCAAAACCGAAAGGGAAATTCAAGAGGACATGGTAATGCAGTGGAAACCAAAGCAGATGCTTGGGAAAAAGCTCAGATGAAGAAAAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Remorin_C

Protein Analysis

97

Amino Acids

10.58

Weight (kDa)

11.0

Isoelectric Point (pI)

43.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 164
AcsI RAATTY 1 cut(s) 220
AfiI CCNNNNNNNGG 2 cut(s) 164, 197
AgsI TTSAA 2 cut(s) 90, 225
AjnI CCWGG 1 cut(s) 149
AloI GAACNNNNNNTCC 2 cut(s) 13, 45
AluBI AGCT 3 cut(s) 86, 140, 275
AluI AGCT 3 cut(s) 86, 140, 275
AoxI GGCC 3 cut(s) 23, 98, 179
ApeKI GCWGC 1 cut(s) 38
ApoI RAATTY 1 cut(s) 220
AspS9I GGNCC 1 cut(s) 112
AvaII GGWCC 1 cut(s) 112
BbvI GCAGC 1 cut(s) 50
BciT130I CCWGG 1 cut(s) 151
BciVI GTATCC 1 cut(s) 165
BclI TGATCA 1 cut(s) 7
BfaI CTAG 1 cut(s) 33
BfmI CTRYAG 1 cut(s) 192
BfuI GTATCC 1 cut(s) 165
BglI GCCNNNNNGGC 1 cut(s) 106
BisI GCNGC 1 cut(s) 39
BlsI GCNGC 1 cut(s) 40
Bme1390I CCNGG 1 cut(s) 151
Bme18I GGWCC 1 cut(s) 112
BmgT120I GGNCC 1 cut(s) 112
BmrFI CCNGG 1 cut(s) 151
BmsI GCATC 1 cut(s) 250
BsaXI ACNNNNNCTCC 2 cut(s) 13, 43
Bsc4I CCNNNNNNNGG 2 cut(s) 164, 197
BseBI CCWGG 1 cut(s) 151
BseLI CCNNNNNNNGG 2 cut(s) 164, 197
BseMII CTCAG 1 cut(s) 290
BseXI GCAGC 1 cut(s) 50
BsgI GTGCAG 1 cut(s) 57
BshFI GGCC 3 cut(s) 25, 100, 181
BslI CCNNNNNNNGG 2 cut(s) 164, 197
BsnI GGCC 3 cut(s) 25, 100, 181
Bsp143I GATC 1 cut(s) 7
BspANI GGCC 3 cut(s) 25, 100, 181
BspCNI CTCAG 1 cut(s) 289
BspMAI CTGCAG 1 cut(s) 196
BssMI GATC 1 cut(s) 7
Bst2UI CCWGG 1 cut(s) 151
BstDEI CTNAG 2 cut(s) 130, 276
BstKTI GATC 1 cut(s) 10
BstMBI GATC 1 cut(s) 7
BstMWI GCNNNNNNNGC 1 cut(s) 106
BstNI CCWGG 1 cut(s) 151
BstSCI CCNGG 1 cut(s) 149
BstSFI CTRYAG 1 cut(s) 192
BstV1I GCAGC 1 cut(s) 50
BsuI GTATCC 1 cut(s) 165
BsuRI GGCC 3 cut(s) 25, 100, 181
BtsI GCAGTG 1 cut(s) 249
BtsIMutI CAGTG 1 cut(s) 249
Cfr13I GGNCC 1 cut(s) 112
CviAII CATG 3 cut(s) 5, 13, 233
CviJI RGCY 6 cut(s) 25, 86, 100, 140, 181, 275
CviKI_1 RGCY 6 cut(s) 25, 86, 100, 140, 181, 275
DdeI CTNAG 2 cut(s) 130, 276
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Eco147I AGGCCT 1 cut(s) 181
Eco47I GGWCC 1 cut(s) 112
EcoRII CCWGG 1 cut(s) 149
EcoT22I ATGCAT 1 cut(s) 6
FaeI CATG 3 cut(s) 8, 16, 236
FaiI YATR 4 cut(s) 6, 14, 176, 234
FatI CATG 3 cut(s) 4, 12, 232
FbaI TGATCA 1 cut(s) 7
Fnu4HI GCNGC 1 cut(s) 39
Fsp4HI GCNGC 1 cut(s) 39
FspBI CTAG 1 cut(s) 33
GluI GCNGC 1 cut(s) 39
HaeIII GGCC 3 cut(s) 25, 100, 181
Hin1II CATG 3 cut(s) 8, 16, 236
HindIII AAGCTT 1 cut(s) 138
Hpy188I TCNGA 1 cut(s) 279
Hpy188III TCNNGA 1 cut(s) 225
HpyCH4V TGCA 4 cut(s) 4, 38, 194, 242
HpyF10VI GCNNNNNNNGC 1 cut(s) 106
HpyF3I CTNAG 2 cut(s) 130, 276
Hsp92II CATG 3 cut(s) 8, 16, 236
Ksp22I TGATCA 1 cut(s) 7
Kzo9I GATC 1 cut(s) 7
LmnI GCTCC 2 cut(s) 65, 83
LpnPI CCDG 4 cut(s) 95, 136, 163, 204
Lsp1109I GCAGC 1 cut(s) 50
LweI GCATC 1 cut(s) 250
MaeI CTAG 1 cut(s) 33
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MluCI AATT 1 cut(s) 220
MmeI TCCRAC 1 cut(s) 209
MnlI CCTC 3 cut(s) 15, 192, 221
Mph1103I ATGCAT 1 cut(s) 6
MslI CAYNNNNRTG 2 cut(s) 15, 237
MspR9I CCNGG 1 cut(s) 151
MvaI CCWGG 1 cut(s) 151
MwoI GCNNNNNNNGC 1 cut(s) 106
NdeII GATC 1 cut(s) 7
NlaIII CATG 3 cut(s) 8, 16, 236
NmeAIII GCCGAG 2 cut(s) 25, 51
NsiI ATGCAT 1 cut(s) 6
PceI AGGCCT 1 cut(s) 181
PflMI CCANNNNNTGG 1 cut(s) 164
PkrI GCNGC 1 cut(s) 40
Psp6I CCWGG 1 cut(s) 149
PspGI CCWGG 1 cut(s) 149
PspPI GGNCC 1 cut(s) 112
PstI CTGCAG 1 cut(s) 196
RseI CAYNNNNRTG 2 cut(s) 15, 237
SatI GCNGC 1 cut(s) 39
Sau3AI GATC 1 cut(s) 7
Sau96I GGNCC 1 cut(s) 112
ScrFI CCNGG 1 cut(s) 151
SetI ASST 5 cut(s) 88, 142, 155, 277, 293
SfaNI GCATC 1 cut(s) 250
SfcI CTRYAG 1 cut(s) 192
SinI GGWCC 1 cut(s) 112
SmiMI CAYNNNNRTG 2 cut(s) 15, 237
Sse9I AATT 1 cut(s) 220
SseBI AGGCCT 1 cut(s) 181
SspMI CTAG 1 cut(s) 33
StuI AGGCCT 1 cut(s) 181
StyD4I CCNGG 1 cut(s) 149
TasI AATT 1 cut(s) 220
TscAI CASTG 1 cut(s) 249
TseI GCWGC 1 cut(s) 38
TspDTI ATGAA 2 cut(s) 29, 107
TspGWI ACGGA 2 cut(s) 135, 213
TspRI CASTG 1 cut(s) 249
Van91I CCANNNNNTGG 1 cut(s) 164
VpaK11BI GGWCC 1 cut(s) 112
XapI RAATTY 1 cut(s) 220
XspI CTAG 1 cut(s) 33
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.