Rh4DG083200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4D
OG0015744
Physical Location & Seq
Reverse (-)
12550713 .. 12564189
13477 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4DG083200.1

Sequence Viewer

Length: 177 bp
ATGATCGAGTGGAACGGTGGGGTGTGGGGGACCATGGGTTCCAAGGATCCTGCTCCGGTGGTTGACAACGTTAAGAGGGCAAAGCAGGTGCCGGTGGACTGGTCTTGTGTGAAAATTAAAGTCGGACAATATCAAGGGGGAATTGTACTTGGTATTAATAAAGTTATCAAATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.34

Weight (kDa)

9.58

Isoelectric Point (pI)

28.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 76
Acc36I ACCTGC 1 cut(s) 76
AccB1I GGYRCC 1 cut(s) 88
AclI AACGTT 1 cut(s) 69
AclWI GGATC 2 cut(s) 41, 54
AcsI RAATTY 1 cut(s) 170
AfaI GTAC 1 cut(s) 147
AloI GAACNNNNNNTCC 2 cut(s) 22, 54
AlwI GGATC 2 cut(s) 41, 54
ApoI RAATTY 1 cut(s) 170
AseI ATTAAT 1 cut(s) 156
AspS9I GGNCC 1 cut(s) 30
AvaII GGWCC 1 cut(s) 30
BamHI GGATCC 1 cut(s) 46
BanI GGYRCC 1 cut(s) 88
BfuAI ACCTGC 1 cut(s) 76
Bme18I GGWCC 1 cut(s) 30
BmgT120I GGNCC 1 cut(s) 30
BmiI GGNNCC 4 cut(s) 31, 40, 48, 90
BsaJI CCNNGG 2 cut(s) 33, 42
BsaWI WCCGGW 1 cut(s) 55
Bse118I RCCGGY 1 cut(s) 91
Bse1I ACTGG 1 cut(s) 104
BseDI CCNNGG 2 cut(s) 33, 42
BseNI ACTGG 1 cut(s) 104
BshNI GGYRCC 1 cut(s) 88
BsiSI CCGG 2 cut(s) 56, 92
BslFI GGGAC 1 cut(s) 43
BsmFI GGGAC 1 cut(s) 43
Bsp143I GATC 2 cut(s) 3, 46
Bsp19I CCATGG 1 cut(s) 33
BspLI GGNNCC 4 cut(s) 31, 40, 48, 90
BspMI ACCTGC 1 cut(s) 76
BspPI GGATC 2 cut(s) 41, 54
BspT107I GGYRCC 1 cut(s) 88
BsrFI RCCGGY 1 cut(s) 91
BsrI ACTGG 1 cut(s) 104
BssAI RCCGGY 1 cut(s) 91
BssECI CCNNGG 2 cut(s) 33, 42
BssMI GATC 2 cut(s) 3, 46
BssT1I CCWWGG 2 cut(s) 33, 42
Bst4CI ACNGT 1 cut(s) 17
BstDSI CCRYGG 1 cut(s) 33
BstKTI GATC 2 cut(s) 6, 49
BstMBI GATC 2 cut(s) 3, 46
BstX2I RGATCY 1 cut(s) 46
BstYI RGATCY 1 cut(s) 46
BtgI CCRYGG 1 cut(s) 33
BveI ACCTGC 1 cut(s) 76
Cfr10I RCCGGY 1 cut(s) 91
Cfr13I GGNCC 1 cut(s) 30
Csp6I GTAC 1 cut(s) 146
CviAII CATG 1 cut(s) 34
CviQI GTAC 1 cut(s) 146
DpnI GATC 2 cut(s) 5, 48
DpnII GATC 2 cut(s) 3, 46
Eco130I CCWWGG 2 cut(s) 33, 42
Eco47I GGWCC 1 cut(s) 30
EcoT14I CCWWGG 2 cut(s) 33, 42
ErhI CCWWGG 2 cut(s) 33, 42
FaeI CATG 1 cut(s) 37
FaiI YATR 1 cut(s) 35
FaqI GGGAC 1 cut(s) 43
FatI CATG 1 cut(s) 33
HapII CCGG 2 cut(s) 56, 92
Hin1II CATG 1 cut(s) 37
HincII GTYRAC 1 cut(s) 64
HindII GTYRAC 1 cut(s) 64
HpaII CCGG 2 cut(s) 56, 92
Hpy166II GTNNAC 2 cut(s) 64, 97
Hpy188I TCNGA 1 cut(s) 125
Hpy8I GTNNAC 2 cut(s) 64, 97
HpyCH4III ACNGT 1 cut(s) 17
HpyCH4IV ACGT 1 cut(s) 69
HpySE526I ACGT 1 cut(s) 69
Hsp92II CATG 1 cut(s) 37
Kzo9I GATC 2 cut(s) 3, 46
LmnI GCTCC 1 cut(s) 58
LpnPI CCDG 5 cut(s) 63, 69, 71, 85, 105
MaeII ACGT 1 cut(s) 69
MalI GATC 2 cut(s) 5, 48
MboI GATC 2 cut(s) 3, 46
MflI RGATCY 1 cut(s) 46
MluCI AATT 3 cut(s) 114, 141, 170
MmeI TCCRAC 1 cut(s) 103
MnlI CCTC 1 cut(s) 69
MseI TTAA 3 cut(s) 72, 117, 156
MspI CCGG 2 cut(s) 56, 92
NcoI CCATGG 1 cut(s) 33
NdeII GATC 2 cut(s) 3, 46
NlaIII CATG 1 cut(s) 37
NlaIV GGNNCC 4 cut(s) 31, 40, 48, 90
PaqCI CACCTGC 1 cut(s) 76
PshBI ATTAAT 1 cut(s) 156
Psp1406I AACGTT 1 cut(s) 69
PspN4I GGNNCC 4 cut(s) 31, 40, 48, 90
PspPI GGNCC 1 cut(s) 30
PsuI RGATCY 1 cut(s) 46
RsaI GTAC 1 cut(s) 147
RsaNI GTAC 1 cut(s) 146
SaqAI TTAA 3 cut(s) 72, 117, 156
Sau3AI GATC 2 cut(s) 3, 46
Sau96I GGNCC 1 cut(s) 30
SetI ASST 2 cut(s) 72, 90
SinI GGWCC 1 cut(s) 30
Sse9I AATT 3 cut(s) 114, 141, 170
StyI CCWWGG 2 cut(s) 33, 42
TaaI ACNGT 1 cut(s) 17
TaiI ACGT 1 cut(s) 72
TaqI TCGA 1 cut(s) 6
TasI AATT 3 cut(s) 114, 141, 170
TatI WGTACW 1 cut(s) 145
Tru1I TTAA 3 cut(s) 72, 117, 156
Tru9I TTAA 3 cut(s) 72, 117, 156
VpaK11BI GGWCC 1 cut(s) 30
VspI ATTAAT 1 cut(s) 156
XapI RAATTY 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.