Rh6CG201700

Anaphase-promoting complex subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
33592339 .. 33593796
1458 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG201700.1

Sequence Viewer

Length: 225 bp
ATGAATTGGGCGGTCAATCTGAAGCCAATGTCAAACAAGGCAACTTGTTCTATGTTATTTCTAACAGGTGGTACTCAAGCCTCTAAAAGAGATGTAGGGGTTATTGTTCAACAATTCAAATCTGACATTGACTTCCAGGAATTTTGCTTGCAAGTGTTATTTGAATGTGTGAGCAAGGACAGGCCTGCTCTTTTACAGGTCTATTTGATATGCTTTTCATCTTGA

Protein Analysis

74

Amino Acids

8.34

Weight (kDa)

7.63

Isoelectric Point (pI)

34.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
APC1_C PF18122 40 - 72 6e-09 Anaphase-promoting complex sub unit 1 C-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AcsI RAATTY 1 cut(s) 140
AcuI CTGAAG 1 cut(s) 41
AfaI GTAC 1 cut(s) 73
AgsI TTSAA 3 cut(s) 110, 118, 164
AjnI CCWGG 1 cut(s) 135
AoxI GGCC 1 cut(s) 182
ApoI RAATTY 1 cut(s) 140
BciT130I CCWGG 1 cut(s) 137
Bme1390I CCNGG 1 cut(s) 137
BmrFI CCNGG 1 cut(s) 137
BpuEI CTTGAG 1 cut(s) 60
BseBI CCWGG 1 cut(s) 137
BshFI GGCC 1 cut(s) 184
BsnI GGCC 1 cut(s) 184
BspACI CCGC 1 cut(s) 11
BspANI GGCC 1 cut(s) 184
Bst2UI CCWGG 1 cut(s) 137
BstC8I GCNNGC 2 cut(s) 149, 186
BstNI CCWGG 1 cut(s) 137
BstSCI CCNGG 1 cut(s) 135
BsuRI GGCC 1 cut(s) 184
Cac8I GCNNGC 2 cut(s) 149, 186
Csp6I GTAC 1 cut(s) 72
CviJI RGCY 3 cut(s) 25, 80, 184
CviKI_1 RGCY 3 cut(s) 25, 80, 184
CviQI GTAC 1 cut(s) 72
Eco147I AGGCCT 1 cut(s) 184
Eco57I CTGAAG 1 cut(s) 41
EcoRII CCWGG 1 cut(s) 135
FaiI YATR 2 cut(s) 53, 211
HaeIII GGCC 1 cut(s) 184
Hpy188I TCNGA 2 cut(s) 21, 124
Hpy188III TCNNGA 1 cut(s) 222
HpyCH4V TGCA 1 cut(s) 151
LpnPI CCDG 6 cut(s) 51, 122, 149, 166, 182, 198
MluCI AATT 3 cut(s) 4, 113, 140
MnlI CCTC 1 cut(s) 91
MspR9I CCNGG 1 cut(s) 137
MvaI CCWGG 1 cut(s) 137
PceI AGGCCT 1 cut(s) 184
PfoI TCCNGGA 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 135
PspGI CCWGG 1 cut(s) 135
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
ScrFI CCNGG 1 cut(s) 137
SetI ASST 2 cut(s) 70, 201
SmlI CTYRAG 1 cut(s) 75
SmoI CTYRAG 1 cut(s) 75
Sse9I AATT 3 cut(s) 4, 113, 140
SseBI AGGCCT 1 cut(s) 184
SsiI CCGC 1 cut(s) 11
StuI AGGCCT 1 cut(s) 184
StyD4I CCNGG 1 cut(s) 135
TasI AATT 3 cut(s) 4, 113, 140
TspDTI ATGAA 2 cut(s) 17, 207
XapI RAATTY 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.