Rh5AG520200

Produces ATP from ADP in the presence of a proton gradient across the membrane

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
88962026 .. 88963043
1018 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG520200.1

Sequence Viewer

Length: 288 bp
ATGATTCACACTAAACCTATCTTTGTTGATCAGGTGGTTTCTCCGTGTTTGCTGGTGTTGGAGAACGCACTCGTGAGGGCTAACTCTGAGGTGTCTGCTTTGCTTGGTCGTATCCCATCTGCCGTCGGATACCAACCTACTTTAGCTACTGATCTTGGAGGTCTTCAAGAGCGTATCACAACCACCAAGAAGGGTTCCATTACTTCTGTCCAAGCTATTTATGTGCCTGCTGATGACTTGACAGATCCTGCTCCTGCAACTACTTTTGCTCACTTGGATACCAGCTAA
Functional Annotation

Protein Analysis

95

Amino Acids

10.03

Weight (kDa)

5.03

Isoelectric Point (pI)

31.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_ab PF00006 24 - 94 3.3e-19 ATP synthase alpha/beta family, nucleotide-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 239
AgsI TTSAA 1 cut(s) 167
AluBI AGCT 3 cut(s) 146, 215, 285
AluI AGCT 3 cut(s) 146, 215, 285
AlwI GGATC 1 cut(s) 239
AlwNI CAGNNNCTG 1 cut(s) 248
BauI CACGAG 1 cut(s) 71
BbsI GAAGAC 1 cut(s) 155
BccI CCATC 1 cut(s) 124
BceAI ACGGC 1 cut(s) 107
BciVI GTATCC 3 cut(s) 122, 122, 271
BclI TGATCA 1 cut(s) 28
BfuI GTATCC 3 cut(s) 122, 122, 271
BmiI GGNNCC 1 cut(s) 196
BpiI GAAGAC 1 cut(s) 155
BseMII CTCAG 1 cut(s) 78
Bsp143I GATC 3 cut(s) 28, 151, 244
BspCNI CTCAG 1 cut(s) 79
BspLI GGNNCC 1 cut(s) 196
BspPI GGATC 1 cut(s) 239
BssMI GATC 3 cut(s) 28, 151, 244
BssSI CACGAG 1 cut(s) 71
Bst2BI CACGAG 1 cut(s) 71
BstC8I GCNNGC 1 cut(s) 228
BstDEI CTNAG 1 cut(s) 87
BstKTI GATC 3 cut(s) 31, 154, 247
BstMBI GATC 3 cut(s) 28, 151, 244
BstV2I GAAGAC 1 cut(s) 155
BstX2I RGATCY 1 cut(s) 244
BstYI RGATCY 1 cut(s) 244
BsuI GTATCC 3 cut(s) 122, 122, 271
Cac8I GCNNGC 1 cut(s) 228
CaiI CAGNNNCTG 1 cut(s) 248
CviJI RGCY 4 cut(s) 80, 146, 215, 285
CviKI_1 RGCY 4 cut(s) 80, 146, 215, 285
DdeI CTNAG 1 cut(s) 87
DpnI GATC 3 cut(s) 30, 153, 246
DpnII GATC 3 cut(s) 28, 151, 244
FaiI YATR 1 cut(s) 222
FbaI TGATCA 1 cut(s) 28
HinfI GANTC 1 cut(s) 4
Hpy188I TCNGA 2 cut(s) 88, 128
Hpy188III TCNNGA 2 cut(s) 73, 167
Hpy99I CGWCG 1 cut(s) 128
HpyAV CCTTC 1 cut(s) 184
HpyCH4V TGCA 1 cut(s) 257
HpyF3I CTNAG 1 cut(s) 87
Ksp22I TGATCA 1 cut(s) 28
Kzo9I GATC 3 cut(s) 28, 151, 244
LmnI GCTCC 1 cut(s) 256
LpnPI CCDG 5 cut(s) 17, 38, 240, 261, 267
MalI GATC 3 cut(s) 30, 153, 246
MboI GATC 3 cut(s) 28, 151, 244
MboII GAAGA 1 cut(s) 155
MflI RGATCY 1 cut(s) 244
MmeI TCCRAC 2 cut(s) 39, 106
MnlI CCTC 3 cut(s) 69, 82, 152
NdeII GATC 3 cut(s) 28, 151, 244
NlaIV GGNNCC 1 cut(s) 196
PfeI GAWTC 1 cut(s) 4
PspN4I GGNNCC 1 cut(s) 196
PstNI CAGNNNCTG 1 cut(s) 248
PsuI RGATCY 1 cut(s) 244
Sau3AI GATC 3 cut(s) 28, 151, 244
SetI ASST 8 cut(s) 19, 36, 93, 139, 148, 163, 217, 287
TfiI GAWTC 1 cut(s) 4
TspGWI ACGGA 1 cut(s) 33
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.