Rh5BG424100

Heavy-metal-associated domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
68554651 .. 68555202
552 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG424100.1

Sequence Viewer

Length: 357 bp
ATGAAAAGAAAGGATAATCTTAATTCTTTGTTCATTTCCTGCTTCCACAGCCATTATGGATCAAAGGTCCATTGTCCGCCGAGGCCATATAGACTACTCATTGAAGATACTGACACCATTAATCCTCCTCCTCATTGTATTCGTGATAACGATGGTCGAGGAAAAAACCAACCCCTTTGTCACATCCCTTGTTCCTCTGATCGGTTACCAATTCACCCTAAATCATTTTATGAGAAATGCAGAAGGAGTTTTTCTAGGCAAAGTAGTAGTAGTGATCACCATCAGCTAAGTAGGAAAAGCAGTGCTGACATACATGAGGGAAGACTAATCATTCCCCTTCATCGACAGGATATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

118

Amino Acids

13.71

Weight (kDa)

9.35

Isoelectric Point (pI)

64.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 77
AclWI GGATC 1 cut(s) 67
AfiI CCNNNNNNNGG 1 cut(s) 201
AgsI TTSAA 1 cut(s) 104
AluBI AGCT 1 cut(s) 286
AluI AGCT 1 cut(s) 286
AlwI GGATC 1 cut(s) 67
AoxI GGCC 1 cut(s) 83
AseI ATTAAT 1 cut(s) 120
AspS9I GGNCC 1 cut(s) 67
AsuHPI GGTGA 2 cut(s) 206, 269
AvaII GGWCC 1 cut(s) 67
BbsI GAAGAC 1 cut(s) 328
BccI CCATC 2 cut(s) 146, 288
BclI TGATCA 1 cut(s) 274
BfaI CTAG 1 cut(s) 255
Bme18I GGWCC 1 cut(s) 67
BmgT120I GGNCC 1 cut(s) 67
BpiI GAAGAC 1 cut(s) 328
BsaBI GATNNNNATC 1 cut(s) 279
BsaJI CCNNGG 1 cut(s) 80
Bsc4I CCNNNNNNNGG 1 cut(s) 201
Bse8I GATNNNNATC 1 cut(s) 279
BseDI CCNNGG 1 cut(s) 80
BseGI GGATG 1 cut(s) 183
BseJI GATNNNNATC 1 cut(s) 279
BseLI CCNNNNNNNGG 1 cut(s) 201
BseRI GAGGAG 2 cut(s) 117, 120
BshFI GGCC 1 cut(s) 85
BslI CCNNNNNNNGG 1 cut(s) 201
BsnI GGCC 1 cut(s) 85
Bsp143I GATC 3 cut(s) 59, 199, 274
BspACI CCGC 1 cut(s) 77
BspANI GGCC 1 cut(s) 85
BspPI GGATC 1 cut(s) 67
BssECI CCNNGG 1 cut(s) 80
BssMI GATC 3 cut(s) 59, 199, 274
BstDEI CTNAG 1 cut(s) 287
BstEII GGTNACC 1 cut(s) 204
BstF5I GGATG 1 cut(s) 183
BstKTI GATC 3 cut(s) 62, 202, 277
BstMBI GATC 3 cut(s) 59, 199, 274
BstMWI GCNNNNNNNGC 1 cut(s) 48
BstPI GGTNACC 1 cut(s) 204
BstV2I GAAGAC 1 cut(s) 328
BsuRI GGCC 1 cut(s) 85
BtsCI GGATG 1 cut(s) 183
BtsI GCAGTG 1 cut(s) 307
BtsIMutI CAGTG 1 cut(s) 307
Cfr13I GGNCC 1 cut(s) 67
CviAII CATG 1 cut(s) 314
CviJI RGCY 3 cut(s) 51, 85, 286
CviKI_1 RGCY 3 cut(s) 51, 85, 286
DdeI CTNAG 1 cut(s) 287
DpnI GATC 3 cut(s) 61, 201, 276
DpnII GATC 3 cut(s) 59, 199, 274
EciI GGCGGA 1 cut(s) 66
Eco32I GATATC 1 cut(s) 352
Eco47I GGWCC 1 cut(s) 67
Eco91I GGTNACC 1 cut(s) 204
EcoO65I GGTNACC 1 cut(s) 204
EcoRV GATATC 1 cut(s) 352
FaeI CATG 1 cut(s) 317
FaiI YATR 6 cut(s) 57, 88, 90, 231, 311, 315
FatI CATG 1 cut(s) 313
FbaI TGATCA 1 cut(s) 274
FokI GGATG 1 cut(s) 170
FspBI CTAG 1 cut(s) 255
HaeIII GGCC 1 cut(s) 85
Hin1II CATG 1 cut(s) 317
HphI GGTGA 2 cut(s) 206, 269
Hpy188I TCNGA 2 cut(s) 199, 356
Hpy188III TCNNGA 1 cut(s) 143
HpyAV CCTTC 2 cut(s) 237, 347
HpyCH4V TGCA 1 cut(s) 240
HpyF10VI GCNNNNNNNGC 1 cut(s) 48
HpyF3I CTNAG 1 cut(s) 287
Hsp92II CATG 1 cut(s) 317
Ksp22I TGATCA 1 cut(s) 274
Kzo9I GATC 3 cut(s) 59, 199, 274
LpnPI CCDG 2 cut(s) 52, 332
MaeI CTAG 1 cut(s) 255
MaeIII GTNAC 2 cut(s) 179, 204
MalI GATC 3 cut(s) 61, 201, 276
MboI GATC 3 cut(s) 59, 199, 274
MboII GAAGA 2 cut(s) 116, 333
MluCI AATT 2 cut(s) 22, 210
MnlI CCTC 7 cut(s) 75, 135, 138, 141, 152, 205, 310
MseI TTAA 2 cut(s) 21, 120
MwoI GCNNNNNNNGC 1 cut(s) 48
NdeII GATC 3 cut(s) 59, 199, 274
NlaIII CATG 1 cut(s) 317
NmeAIII GCCGAG 1 cut(s) 105
NmuCI GTSAC 1 cut(s) 179
PshBI ATTAAT 1 cut(s) 120
PspEI GGTNACC 1 cut(s) 204
PspPI GGNCC 1 cut(s) 67
SaqAI TTAA 2 cut(s) 21, 120
Sau3AI GATC 3 cut(s) 59, 199, 274
Sau96I GGNCC 1 cut(s) 67
SetI ASST 2 cut(s) 69, 288
SgeI CNNG 7 cut(s) 51, 93, 155, 170, 201, 267, 326
SinI GGWCC 1 cut(s) 67
Sse9I AATT 2 cut(s) 22, 210
SsiI CCGC 1 cut(s) 77
SspMI CTAG 1 cut(s) 255
TaqI TCGA 2 cut(s) 157, 343
TasI AATT 2 cut(s) 22, 210
Tru1I TTAA 2 cut(s) 21, 120
Tru9I TTAA 2 cut(s) 21, 120
TscAI CASTG 1 cut(s) 307
TseFI GTSAC 1 cut(s) 179
Tsp45I GTSAC 1 cut(s) 179
TspDTI ATGAA 3 cut(s) 17, 22, 329
TspRI CASTG 1 cut(s) 307
VpaK11BI GGWCC 1 cut(s) 67
VspI ATTAAT 1 cut(s) 120
XcmI CCANNNNNNNNNTGG 1 cut(s) 53
XspI CTAG 1 cut(s) 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.