Rh5CG462400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
64468696 .. 64468990
295 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG462400.1

Sequence Viewer

Length: 180 bp
ATGACATCTCACGGGCATTATGCATTAACATTTCGTGAAAGAGAACATAGAAGGAATGAATGTGAGCAGTTAGAAGGAATGAGGACAACAAATGAAATGGAATATGGAAGAGAAATTTCAAACCAACCAAAGCAACATCTTGATCAGCCTTGTCTTCACAACATCAACATGGCATTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

7.12

Weight (kDa)

6.17

Isoelectric Point (pI)

65.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 114
AgsI TTSAA 1 cut(s) 120
ApoI RAATTY 1 cut(s) 114
BbsI GAAGAC 1 cut(s) 146
BclI TGATCA 1 cut(s) 142
BpiI GAAGAC 1 cut(s) 146
BsmI GAATGC 1 cut(s) 173
Bsp143I GATC 1 cut(s) 142
BssMI GATC 1 cut(s) 142
Bst6I CTCTTC 1 cut(s) 103
BstKTI GATC 1 cut(s) 145
BstMBI GATC 1 cut(s) 142
BstV2I GAAGAC 1 cut(s) 146
CviAII CATG 1 cut(s) 169
CviJI RGCY 1 cut(s) 148
CviKI_1 RGCY 1 cut(s) 148
DpnI GATC 1 cut(s) 144
DpnII GATC 1 cut(s) 142
Eam1104I CTCTTC 1 cut(s) 103
EarI CTCTTC 1 cut(s) 103
EcoT22I ATGCAT 1 cut(s) 25
FaeI CATG 1 cut(s) 172
FaiI YATR 4 cut(s) 21, 48, 105, 170
FatI CATG 1 cut(s) 168
FbaI TGATCA 1 cut(s) 142
FspEI CC 9 cut(s) 37, 60, 67, 83, 90, 137, 141, 155, 162
Hin1II CATG 1 cut(s) 172
Hpy188III TCNNGA 2 cut(s) 35, 140
HpyAV CCTTC 2 cut(s) 45, 68
HpyCH4V TGCA 1 cut(s) 23
Hsp92II CATG 1 cut(s) 172
Ksp22I TGATCA 1 cut(s) 142
Kzo9I GATC 1 cut(s) 142
MalI GATC 1 cut(s) 144
MboI GATC 1 cut(s) 142
MboII GAAGA 2 cut(s) 120, 146
MluCI AATT 1 cut(s) 114
MnlI CCTC 1 cut(s) 75
Mph1103I ATGCAT 1 cut(s) 25
MseI TTAA 1 cut(s) 26
MslI CAYNNNNRTG 1 cut(s) 167
Mva1269I GAATGC 1 cut(s) 173
NdeII GATC 1 cut(s) 142
NlaIII CATG 1 cut(s) 172
NsiI ATGCAT 1 cut(s) 25
PctI GAATGC 1 cut(s) 173
RseI CAYNNNNRTG 1 cut(s) 167
SaqAI TTAA 1 cut(s) 26
Sau3AI GATC 1 cut(s) 142
SgeI CNNG 5 cut(s) 23, 25, 47, 152, 162
SmiMI CAYNNNNRTG 1 cut(s) 167
Sse9I AATT 1 cut(s) 114
TasI AATT 1 cut(s) 114
Tru1I TTAA 1 cut(s) 26
Tru9I TTAA 1 cut(s) 26
TspDTI ATGAA 2 cut(s) 72, 108
XapI RAATTY 1 cut(s) 114
Zsp2I ATGCAT 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.