Rh5DG267800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
32439081 .. 32439407
327 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG267800.1

Sequence Viewer

Length: 327 bp
ATGTCTGGACAATGGTTATGCAGGCTGATCTCAAGAGCTTGGGAGATACCTAGCACACGATATGAAGAACCCAAGTTGATGAACAGAAGCTCATTTCAACTGTTGTCTAATGAAGATGGTGTCTCTCTTGAATATTATAATTGCCCAACAAGTGGAGGTAACTCAAGTGCTCACTATTATACTGGTGTGGTTTCTGCAGCTCTCACAGTTTGGGGTTATAGAGTAACTCGTGATTCTGAGTTTCACTTAAATCTCAAGTTTCTGACACTTATTTTCAATCATTTAATAGGATCAATGCCCATTTCTTGGATAAACTTTTTCAAGACG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

109

Amino Acids

12.55

Weight (kDa)

7.81

Isoelectric Point (pI)

37.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 138
AccB7I CCANNNNNTGG 2 cut(s) 152, 306
AclWI GGATC 1 cut(s) 298
AfiI CCNNNNNNNGG 2 cut(s) 152, 306
AgsI TTSAA 4 cut(s) 98, 131, 277, 322
AluBI AGCT 3 cut(s) 38, 90, 200
AluI AGCT 3 cut(s) 38, 90, 200
Alw21I GWGCWC 1 cut(s) 172
Alw26I GTCTC 1 cut(s) 127
AlwI GGATC 1 cut(s) 298
ApeKI GCWGC 1 cut(s) 197
BauI CACGAG 1 cut(s) 228
Bbv12I GWGCWC 1 cut(s) 172
BbvI GCAGC 1 cut(s) 209
BccI CCATC 1 cut(s) 110
BcoDI GTCTC 1 cut(s) 127
BfaI CTAG 1 cut(s) 51
BfmI CTRYAG 1 cut(s) 195
BisI GCNGC 1 cut(s) 198
BlsI GCNGC 1 cut(s) 199
BpuEI CTTGAG 3 cut(s) 16, 148, 239
Bsc4I CCNNNNNNNGG 2 cut(s) 152, 306
Bse1I ACTGG 1 cut(s) 187
BseLI CCNNNNNNNGG 2 cut(s) 152, 306
BseMII CTCAG 1 cut(s) 228
BseNI ACTGG 1 cut(s) 187
BseXI GCAGC 1 cut(s) 209
BsiHKAI GWGCWC 1 cut(s) 172
BslI CCNNNNNNNGG 2 cut(s) 152, 306
BsmAI GTCTC 1 cut(s) 127
Bsp1286I GDGCHC 1 cut(s) 172
Bsp143I GATC 2 cut(s) 27, 290
BspCNI CTCAG 1 cut(s) 229
BspMAI CTGCAG 1 cut(s) 199
BspPI GGATC 1 cut(s) 298
BsrI ACTGG 1 cut(s) 187
BssMI GATC 2 cut(s) 27, 290
BssSI CACGAG 1 cut(s) 228
Bst2BI CACGAG 1 cut(s) 228
Bst4CI ACNGT 2 cut(s) 102, 208
BstC8I GCNNGC 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 237
BstKTI GATC 2 cut(s) 30, 293
BstMAI GTCTC 1 cut(s) 127
BstMBI GATC 2 cut(s) 27, 290
BstSFI CTRYAG 1 cut(s) 195
BstV1I GCAGC 1 cut(s) 209
Cac8I GCNNGC 1 cut(s) 23
CviJI RGCY 4 cut(s) 25, 38, 90, 200
CviKI_1 RGCY 4 cut(s) 25, 38, 90, 200
DdeI CTNAG 1 cut(s) 237
DpnI GATC 2 cut(s) 29, 292
DpnII GATC 2 cut(s) 27, 290
FaiI YATR 5 cut(s) 19, 63, 138, 180, 219
Fnu4HI GCNGC 1 cut(s) 198
Fsp4HI GCNGC 1 cut(s) 198
FspBI CTAG 1 cut(s) 51
GluI GCNGC 1 cut(s) 198
HinfI GANTC 1 cut(s) 233
Hpy188I TCNGA 2 cut(s) 238, 264
Hpy188III TCNNGA 5 cut(s) 6, 33, 128, 230, 322
HpyCH4III ACNGT 2 cut(s) 102, 208
HpyCH4V TGCA 2 cut(s) 21, 197
HpyF3I CTNAG 1 cut(s) 237
Kzo9I GATC 2 cut(s) 27, 290
LpnPI CCDG 2 cut(s) 7, 168
Lsp1109I GCAGC 1 cut(s) 209
MaeI CTAG 1 cut(s) 51
MaeIII GTNAC 2 cut(s) 158, 223
MalI GATC 2 cut(s) 29, 292
MboI GATC 2 cut(s) 27, 290
MboII GAAGA 2 cut(s) 77, 125
MhlI GDGCHC 1 cut(s) 172
MluCI AATT 1 cut(s) 139
MnlI CCTC 1 cut(s) 149
MseI TTAA 2 cut(s) 248, 284
NdeII GATC 2 cut(s) 27, 290
PfeI GAWTC 1 cut(s) 233
PflMI CCANNNNNTGG 2 cut(s) 152, 306
PkrI GCNGC 1 cut(s) 199
PsiI TTATAA 1 cut(s) 138
PstI CTGCAG 1 cut(s) 199
SaqAI TTAA 2 cut(s) 248, 284
SatI GCNGC 1 cut(s) 198
Sau3AI GATC 2 cut(s) 27, 290
SduI GDGCHC 1 cut(s) 172
SetI ASST 5 cut(s) 40, 52, 92, 160, 202
SfcI CTRYAG 1 cut(s) 195
SmlI CTYRAG 3 cut(s) 31, 163, 254
SmoI CTYRAG 3 cut(s) 31, 163, 254
Sse9I AATT 1 cut(s) 139
SspI AATATT 1 cut(s) 134
SspMI CTAG 1 cut(s) 51
TaaI ACNGT 2 cut(s) 102, 208
TasI AATT 1 cut(s) 139
TfiI GAWTC 1 cut(s) 233
Tru1I TTAA 2 cut(s) 248, 284
Tru9I TTAA 2 cut(s) 248, 284
TseI GCWGC 1 cut(s) 197
TspDTI ATGAA 3 cut(s) 78, 95, 126
Van91I CCANNNNNTGG 2 cut(s) 152, 306
XspI CTAG 1 cut(s) 51
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.