Rh6AG013600

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6A
OG0008878
Physical Location & Seq
Forward (+)
1434181 .. 1435570
1390 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6AG013600.1

Sequence Viewer

Length: 348 bp
ATGTTTGCATCGGTCAATCATTCCGAAGATGATGACAGCGAGGAAGAGGATGAGAAAAACGAAAATGGAGGTGTAAACCCAGACCATTGCAAAATGTTTGAGCTTACCCACGTCCACGATAATGAAAAACCTGATGAACCGAATTCTAAAGCTATTGCCTTGATGAAGGACAAGATTGACAAGATGAAGACTACAAAGAGGGCATCCCAACTTCCAGAGGTTCTTAATGATTTTGAAATCAATGAAGTATATGCGTCTGTGCTTGGAAAAGAGACACGTGGAGGGGTGCGAGGATTTGGCATTGGAGCCATACCTGAACAAGTTCCTGGTGTACTAGTGCAGAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

115

Amino Acids

12.77

Weight (kDa)

4.77

Isoelectric Point (pI)

38.09

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transposase_24 PF03004 16 - 102 2.5e-07 Plant transposase (Ptta/En/Spm family)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 142
AcvI CACGTG 1 cut(s) 278
AfaI GTAC 1 cut(s) 333
AflIII ACRYGT 1 cut(s) 275
AgsI TTSAA 1 cut(s) 236
AhlI ACTAGT 1 cut(s) 334
AjiI CACGTC 1 cut(s) 112
AjnI CCWGG 1 cut(s) 325
AluBI AGCT 2 cut(s) 103, 152
AluI AGCT 2 cut(s) 103, 152
Alw26I GTCTC 1 cut(s) 266
ApoI RAATTY 1 cut(s) 142
Asp700I GAANNNNTTC 1 cut(s) 321
BbrPI CACGTG 1 cut(s) 278
BbsI GAAGAC 1 cut(s) 194
BciT130I CCWGG 1 cut(s) 327
BcoDI GTCTC 1 cut(s) 266
BcuI ACTAGT 1 cut(s) 334
BfaI CTAG 1 cut(s) 335
Bme1390I CCNGG 1 cut(s) 327
BmgBI CACGTC 1 cut(s) 112
BmiI GGNNCC 1 cut(s) 307
BmrFI CCNGG 1 cut(s) 327
BmsI GCATC 2 cut(s) 17, 212
BpiI GAAGAC 1 cut(s) 194
BsaAI YACGTR 1 cut(s) 278
Bse3DI GCAATG 1 cut(s) 85
BseBI CCWGG 1 cut(s) 327
BseGI GGATG 2 cut(s) 55, 203
BseMI GCAATG 1 cut(s) 85
BsmAI GTCTC 1 cut(s) 266
BspLI GGNNCC 1 cut(s) 307
BsrDI GCAATG 1 cut(s) 85
Bst2UI CCWGG 1 cut(s) 327
Bst6I CTCTTC 1 cut(s) 39
BstBAI YACGTR 1 cut(s) 278
BstF5I GGATG 2 cut(s) 55, 203
BstMAI GTCTC 1 cut(s) 266
BstNI CCWGG 1 cut(s) 327
BstSCI CCNGG 1 cut(s) 325
BstV2I GAAGAC 1 cut(s) 194
BtrI CACGTC 1 cut(s) 112
BtsCI GGATG 2 cut(s) 55, 203
CseI GACGC 1 cut(s) 243
Csp6I GTAC 1 cut(s) 332
CviJI RGCY 3 cut(s) 103, 152, 308
CviKI_1 RGCY 3 cut(s) 103, 152, 308
CviQI GTAC 1 cut(s) 332
Eam1104I CTCTTC 1 cut(s) 39
EarI CTCTTC 1 cut(s) 39
Eco72I CACGTG 1 cut(s) 278
EcoRI GAATTC 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 325
FaiI YATR 3 cut(s) 250, 252, 311
FokI GGATG 2 cut(s) 62, 190
FspBI CTAG 1 cut(s) 335
HgaI GACGC 1 cut(s) 243
Hpy166II GTNNAC 3 cut(s) 76, 115, 332
Hpy188I TCNGA 1 cut(s) 25
Hpy188III TCNNGA 1 cut(s) 215
Hpy8I GTNNAC 3 cut(s) 76, 115, 332
HpyAV CCTTC 1 cut(s) 160
HpyCH4IV ACGT 2 cut(s) 111, 277
HpyCH4V TGCA 3 cut(s) 8, 90, 340
HpySE526I ACGT 2 cut(s) 111, 277
LmnI GCTCC 1 cut(s) 305
LpnPI CCDG 6 cut(s) 93, 144, 228, 312, 327, 339
LweI GCATC 2 cut(s) 17, 212
MaeI CTAG 1 cut(s) 335
MaeII ACGT 2 cut(s) 111, 277
MboII GAAGA 3 cut(s) 38, 56, 199
MluCI AATT 1 cut(s) 142
MnlI CCTC 7 cut(s) 34, 40, 62, 192, 211, 275, 284
MroXI GAANNNNTTC 1 cut(s) 321
MseI TTAA 1 cut(s) 225
MslI CAYNNNNRTG 1 cut(s) 120
MspR9I CCNGG 1 cut(s) 327
MvaI CCWGG 1 cut(s) 327
NlaIV GGNNCC 1 cut(s) 307
PdmI GAANNNNTTC 1 cut(s) 321
PmaCI CACGTG 1 cut(s) 278
PmlI CACGTG 1 cut(s) 278
Ppu21I YACGTR 1 cut(s) 278
Psp6I CCWGG 1 cut(s) 325
PspCI CACGTG 1 cut(s) 278
PspGI CCWGG 1 cut(s) 325
PspN4I GGNNCC 1 cut(s) 307
RsaI GTAC 1 cut(s) 333
RsaNI GTAC 1 cut(s) 332
RseI CAYNNNNRTG 1 cut(s) 120
SaqAI TTAA 1 cut(s) 225
ScrFI CCNGG 1 cut(s) 327
SetI ASST 8 cut(s) 73, 105, 114, 133, 154, 222, 280, 316
SfaNI GCATC 2 cut(s) 17, 212
SmiMI CAYNNNNRTG 1 cut(s) 120
SpeI ACTAGT 1 cut(s) 334
Sse9I AATT 1 cut(s) 142
SspMI CTAG 1 cut(s) 335
StyD4I CCNGG 1 cut(s) 325
TaiI ACGT 2 cut(s) 114, 280
TasI AATT 1 cut(s) 142
TatI WGTACW 1 cut(s) 331
Tru1I TTAA 1 cut(s) 225
Tru9I TTAA 1 cut(s) 225
TspDTI ATGAA 5 cut(s) 138, 150, 179, 200, 258
XapI RAATTY 1 cut(s) 142
XmnI GAANNNNTTC 1 cut(s) 321
XspI CTAG 1 cut(s) 335
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.