Rh6CG080300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
8704592 .. 8722534
17943 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG080300.1

Sequence Viewer

Length: 180 bp
ATGTTTGAGCTTACCCATGTCCACGATAATGAAAAACCTGATGAAACGAATTCTAAAGCCATTGCCTTGATGAAGGACAAGATTGACAAGACGAAGACTACAAAGAGGGCATCCCAACTTCCAGAGATTGATAGGCTTACATGGCTAAAAATATGTAGTGTAGATGTTAACATACCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.81

Weight (kDa)

6.71

Isoelectric Point (pI)

18.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 49
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
ApoI RAATTY 1 cut(s) 49
BbsI GAAGAC 1 cut(s) 101
BmsI GCATC 1 cut(s) 119
BpiI GAAGAC 1 cut(s) 101
Bse3DI GCAATG 1 cut(s) 60
BseGI GGATG 1 cut(s) 110
BseMI GCAATG 1 cut(s) 60
BsrDI GCAATG 1 cut(s) 60
BstF5I GGATG 1 cut(s) 110
BstMWI GCNNNNNNNGC 1 cut(s) 142
BstV2I GAAGAC 1 cut(s) 101
BtsCI GGATG 1 cut(s) 110
CviAII CATG 2 cut(s) 17, 141
CviJI RGCY 4 cut(s) 10, 59, 136, 145
CviKI_1 RGCY 4 cut(s) 10, 59, 136, 145
EcoRI GAATTC 1 cut(s) 49
FaeI CATG 2 cut(s) 20, 144
FaiI YATR 5 cut(s) 18, 142, 154, 173, 178
FatI CATG 2 cut(s) 16, 140
FokI GGATG 1 cut(s) 97
Hin1II CATG 2 cut(s) 20, 144
HincII GTYRAC 1 cut(s) 169
HindII GTYRAC 1 cut(s) 169
HpaI GTTAAC 1 cut(s) 169
Hpy166II GTNNAC 2 cut(s) 22, 169
Hpy188III TCNNGA 1 cut(s) 122
Hpy8I GTNNAC 2 cut(s) 22, 169
HpyAV CCTTC 1 cut(s) 67
HpyF10VI GCNNNNNNNGC 1 cut(s) 142
Hsp92II CATG 2 cut(s) 20, 144
KspAI GTTAAC 1 cut(s) 169
LpnPI CCDG 2 cut(s) 51, 135
LweI GCATC 1 cut(s) 119
MboII GAAGA 1 cut(s) 106
MluCI AATT 1 cut(s) 49
MnlI CCTC 1 cut(s) 99
MseI TTAA 1 cut(s) 168
MslI CAYNNNNRTG 1 cut(s) 27
MwoI GCNNNNNNNGC 1 cut(s) 142
NlaIII CATG 2 cut(s) 20, 144
RseI CAYNNNNRTG 1 cut(s) 27
SaqAI TTAA 1 cut(s) 168
SetI ASST 2 cut(s) 12, 40
SfaNI GCATC 1 cut(s) 119
SgeI CNNG 8 cut(s) 29, 35, 50, 79, 91, 100, 134, 153
SmiMI CAYNNNNRTG 1 cut(s) 27
Sse9I AATT 1 cut(s) 49
TasI AATT 1 cut(s) 49
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TspDTI ATGAA 3 cut(s) 45, 57, 86
XapI RAATTY 1 cut(s) 49
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.