Rh6BG327600

Protein of unknown function (DUF2439)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
OG0012644
Physical Location & Seq
Reverse (-)
56055533 .. 56057748
2216 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG327600.1

Sequence Viewer

Length: 207 bp
ATGACATTGTGGAAGGAGAGCACTCCTTCTAGACAGGAGCACTCCTATAGGGAAACCATTCGAGCTTTTCTGGTTTATTTTCAGAATCAGGCTTTGTACACCACACAGCTAACTCAGAAGCCGAAGAAGTATCATGATGGTTTCTTGCAACTAGCAATTACTGGGTCTCGTGGAAAGCAGGACAATAAGCGTAGACGAGTAGTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2439

Protein Analysis

68

Amino Acids

8.15

Weight (kDa)

10.34

Isoelectric Point (pI)

53.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ZGRF1-like_N PF10382 30 - 57 3.6e-06 DNA helicase ZGRF1-like, N-terminal domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 193
AfaI GTAC 1 cut(s) 98
AhdI GACNNNNNGTC 1 cut(s) 200
AluBI AGCT 2 cut(s) 65, 109
AluI AGCT 2 cut(s) 65, 109
Alw21I GWGCWC 2 cut(s) 23, 42
Alw26I GTCTC 1 cut(s) 171
Asp700I GAANNNNTTC 1 cut(s) 57
BauI CACGAG 1 cut(s) 168
Bbv12I GWGCWC 2 cut(s) 23, 42
BccI CCATC 1 cut(s) 131
BcoDI GTCTC 1 cut(s) 171
BfaI CTAG 3 cut(s) 30, 152, 205
BfmI CTRYAG 1 cut(s) 46
BmeRI GACNNNNNGTC 1 cut(s) 200
BmrI ACTGGG 1 cut(s) 171
BmuI ACTGGG 1 cut(s) 171
BsaI GGTCTC 1 cut(s) 171
Bse1I ACTGG 1 cut(s) 166
BseMII CTCAG 1 cut(s) 128
BseNI ACTGG 1 cut(s) 166
BsiHKAI GWGCWC 2 cut(s) 23, 42
BsmAI GTCTC 1 cut(s) 171
Bso31I GGTCTC 1 cut(s) 171
Bsp1286I GDGCHC 2 cut(s) 23, 42
Bsp1407I TGTACA 1 cut(s) 96
BspCNI CTCAG 1 cut(s) 127
BspHI TCATGA 1 cut(s) 133
BspTNI GGTCTC 1 cut(s) 171
BsrGI TGTACA 1 cut(s) 96
BsrI ACTGG 1 cut(s) 166
BssSI CACGAG 1 cut(s) 168
Bst2BI CACGAG 1 cut(s) 168
BstAUI TGTACA 1 cut(s) 96
BstDEI CTNAG 1 cut(s) 114
BstMAI GTCTC 1 cut(s) 171
BstSFI CTRYAG 1 cut(s) 46
CciI TCATGA 1 cut(s) 133
Csp6I GTAC 1 cut(s) 97
CviAII CATG 1 cut(s) 134
CviJI RGCY 4 cut(s) 65, 92, 109, 121
CviKI_1 RGCY 4 cut(s) 65, 92, 109, 121
CviQI GTAC 1 cut(s) 97
DdeI CTNAG 1 cut(s) 114
DriI GACNNNNNGTC 1 cut(s) 200
Eam1105I GACNNNNNGTC 1 cut(s) 200
Eco31I GGTCTC 1 cut(s) 171
FaeI CATG 1 cut(s) 137
FaiI YATR 2 cut(s) 48, 135
FatI CATG 1 cut(s) 133
FblI GTMKAC 1 cut(s) 193
FspBI CTAG 3 cut(s) 30, 152, 205
Hin1II CATG 1 cut(s) 137
HinfI GANTC 1 cut(s) 85
Hpy166II GTNNAC 2 cut(s) 99, 194
Hpy188I TCNGA 2 cut(s) 84, 117
Hpy188III TCNNGA 2 cut(s) 30, 134
Hpy8I GTNNAC 2 cut(s) 99, 194
HpyAV CCTTC 2 cut(s) 7, 36
HpyCH4V TGCA 1 cut(s) 148
HpyF3I CTNAG 1 cut(s) 114
Hsp92II CATG 1 cut(s) 137
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 5 cut(s) 20, 56, 74, 147, 164
MaeI CTAG 3 cut(s) 30, 152, 205
MboII GAAGA 1 cut(s) 136
MhlI GDGCHC 2 cut(s) 23, 42
MluCI AATT 1 cut(s) 156
MroXI GAANNNNTTC 1 cut(s) 57
NlaIII CATG 1 cut(s) 137
PagI TCATGA 1 cut(s) 133
PdmI GAANNNNTTC 1 cut(s) 57
PfeI GAWTC 1 cut(s) 85
RsaI GTAC 1 cut(s) 98
RsaNI GTAC 1 cut(s) 97
SduI GDGCHC 2 cut(s) 23, 42
SetI ASST 2 cut(s) 67, 111
SfcI CTRYAG 1 cut(s) 46
Sse9I AATT 1 cut(s) 156
SspMI CTAG 3 cut(s) 30, 152, 205
TaqI TCGA 1 cut(s) 61
TasI AATT 1 cut(s) 156
TatI WGTACW 1 cut(s) 96
TfiI GAWTC 1 cut(s) 85
XbaI TCTAGA 1 cut(s) 29
XmiI GTMKAC 1 cut(s) 193
XmnI GAANNNNTTC 1 cut(s) 57
XspI CTAG 3 cut(s) 30, 152, 205
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.