Rh6CG229200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Reverse (-)
38452595 .. 38452870
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG229200.1

Sequence Viewer

Length: 276 bp
ATGGTACTTTGGTATCTCATTAGCCCAGCTACTCCCTGTCGGTGTCGCCCTTCCTGGAACGCCTCACTTGGTCTCGCTAATGATACCAAACTCGGTCTCGCAGCCTTGTCATTTGCACTTCATCCTTCCGATACCGGCAACATCTACACTCCTCGGTGTCGGCATTCTCAGTCTCTCCCTTTCGCTATCACAACCTGGCATTATAGCTCAATCTCACAACTCGGTATCGCCAACTCCGACTATCGATATCGCAACCTTAGACCCTCGGTATCGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.16

Weight (kDa)

9.57

Isoelectric Point (pI)

48.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 6
AjnI CCWGG 2 cut(s) 53, 194
AluBI AGCT 2 cut(s) 29, 207
AluI AGCT 2 cut(s) 29, 207
Alw26I GTCTC 3 cut(s) 77, 101, 177
ApeKI GCWGC 1 cut(s) 101
BaeI ACNNNNGTAYC 2 cut(s) 29, 29
BbvI GCAGC 1 cut(s) 113
BciT130I CCWGG 2 cut(s) 55, 196
BcoDI GTCTC 3 cut(s) 77, 101, 177
BisI GCNGC 1 cut(s) 102
BlsI GCNGC 1 cut(s) 103
Bme1390I CCNGG 2 cut(s) 55, 196
BmrFI CCNGG 2 cut(s) 55, 196
Bsa29I ATCGAT 1 cut(s) 244
BsaI GGTCTC 2 cut(s) 77, 101
BsaJI CCNNGG 2 cut(s) 152, 264
Bse118I RCCGGY 1 cut(s) 134
BseBI CCWGG 2 cut(s) 55, 196
BseCI ATCGAT 1 cut(s) 244
BseDI CCNNGG 2 cut(s) 152, 264
BseGI GGATG 1 cut(s) 121
BseMII CTCAG 1 cut(s) 182
BseRI GAGGAG 1 cut(s) 141
BseXI GCAGC 1 cut(s) 113
BseYI CCCAGC 1 cut(s) 25
BshVI ATCGAT 1 cut(s) 244
BsiSI CCGG 1 cut(s) 135
BsmAI GTCTC 3 cut(s) 77, 101, 177
BsmI GAATGC 1 cut(s) 163
Bso31I GGTCTC 2 cut(s) 77, 101
BspCNI CTCAG 1 cut(s) 181
BspDI ATCGAT 1 cut(s) 244
BspTNI GGTCTC 2 cut(s) 77, 101
BsrFI RCCGGY 1 cut(s) 134
BssAI RCCGGY 1 cut(s) 134
BssECI CCNNGG 2 cut(s) 152, 264
Bst2UI CCWGG 2 cut(s) 55, 196
BstDEI CTNAG 2 cut(s) 168, 257
BstF5I GGATG 1 cut(s) 121
BstMAI GTCTC 3 cut(s) 77, 101, 177
BstNI CCWGG 2 cut(s) 55, 196
BstSCI CCNGG 2 cut(s) 53, 194
BstV1I GCAGC 1 cut(s) 113
Bsu15I ATCGAT 1 cut(s) 244
BsuTUI ATCGAT 1 cut(s) 244
BtsCI GGATG 1 cut(s) 121
Cfr10I RCCGGY 1 cut(s) 134
ClaI ATCGAT 1 cut(s) 244
Csp6I GTAC 1 cut(s) 5
CviJI RGCY 4 cut(s) 24, 29, 104, 207
CviKI_1 RGCY 4 cut(s) 24, 29, 104, 207
CviQI GTAC 1 cut(s) 5
DdeI CTNAG 2 cut(s) 168, 257
Eco31I GGTCTC 2 cut(s) 77, 101
Eco32I GATATC 1 cut(s) 248
EcoRII CCWGG 2 cut(s) 53, 194
EcoRV GATATC 1 cut(s) 248
FaiI YATR 1 cut(s) 204
Fnu4HI GCNGC 1 cut(s) 102
FokI GGATG 1 cut(s) 108
Fsp4HI GCNGC 1 cut(s) 102
GluI GCNGC 1 cut(s) 102
GsaI CCCAGC 1 cut(s) 29
HapII CCGG 1 cut(s) 135
HpaII CCGG 1 cut(s) 135
Hpy188I TCNGA 2 cut(s) 130, 238
HpyAV CCTTC 2 cut(s) 60, 135
HpyCH4V TGCA 1 cut(s) 116
HpyF3I CTNAG 2 cut(s) 168, 257
LpnPI CCDG 7 cut(s) 39, 40, 49, 67, 148, 181, 208
Lsp1109I GCAGC 1 cut(s) 113
MmeI TCCRAC 1 cut(s) 261
MnlI CCTC 3 cut(s) 73, 162, 274
MspI CCGG 1 cut(s) 135
MspR9I CCNGG 2 cut(s) 55, 196
Mva1269I GAATGC 1 cut(s) 163
MvaI CCWGG 2 cut(s) 55, 196
PcsI WCGNNNNNNNCGW 1 cut(s) 234
PctI GAATGC 1 cut(s) 163
PfoI TCCNGGA 1 cut(s) 53
PkrI GCNGC 1 cut(s) 103
Psp6I CCWGG 2 cut(s) 53, 194
PspFI CCCAGC 1 cut(s) 25
PspGI CCWGG 2 cut(s) 53, 194
RsaI GTAC 1 cut(s) 6
RsaNI GTAC 1 cut(s) 5
SatI GCNGC 1 cut(s) 102
ScrFI CCNGG 2 cut(s) 55, 196
SetI ASST 4 cut(s) 31, 197, 209, 258
StyD4I CCNGG 2 cut(s) 53, 194
TaqI TCGA 1 cut(s) 244
TaqII GACCGA 1 cut(s) 83
TseI GCWGC 1 cut(s) 101
TspDTI ATGAA 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.