Rh6DG016400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
Physical Location & Seq
Forward (+)
1555788 .. 1556136
349 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG016400.1

Sequence Viewer

Length: 243 bp
ATGGCCGTTGAAGCTCGTACCCGAAACTTTGGAGAACAATGGAGCGCGCTCGGGGATTATGGTTATCATGGTGAAGGTAACGACCATGATGATGGTGAAGTCAGTGAAGATGGTAATGTTGATCAGGCCAATGGAGATGTTGAAGATGATAATGAATACATTAACAAAGTAGAAGGTAATGATCAGGATAAAGAAATGTATGATGAAGGATATCCAGATTTGATGCGGAGGACGTTGTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

9.11

Weight (kDa)

4.05

Isoelectric Point (pI)

23.99

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 47
AciI CCGC 1 cut(s) 226
AcoI YGGCCR 1 cut(s) 3
AfaI GTAC 1 cut(s) 19
AgsI TTSAA 2 cut(s) 11, 143
AluBI AGCT 1 cut(s) 14
AluI AGCT 1 cut(s) 14
Ama87I CYCGRG 1 cut(s) 50
AoxI GGCC 2 cut(s) 3, 126
AspLEI GCGC 2 cut(s) 47, 49
AsuHPI GGTGA 2 cut(s) 83, 107
AvaI CYCGRG 1 cut(s) 50
BccI CCATC 2 cut(s) 86, 104
BclI TGATCA 2 cut(s) 121, 181
BmeT110I CYCGRG 1 cut(s) 50
BmsI GCATC 1 cut(s) 213
BsePI GCGCGC 1 cut(s) 45
Bsh1236I CGCG 1 cut(s) 47
BshFI GGCC 2 cut(s) 5, 128
BsiHKCI CYCGRG 1 cut(s) 50
BsnI GGCC 2 cut(s) 5, 128
BsoBI CYCGRG 1 cut(s) 50
Bsp143I GATC 2 cut(s) 121, 181
BspACI CCGC 1 cut(s) 226
BspANI GGCC 2 cut(s) 5, 128
BspFNI CGCG 1 cut(s) 47
BssHII GCGCGC 1 cut(s) 45
BssMI GATC 2 cut(s) 121, 181
BstC8I GCNNGC 1 cut(s) 47
BstFNI CGCG 1 cut(s) 47
BstHHI GCGC 2 cut(s) 47, 49
BstKTI GATC 2 cut(s) 124, 184
BstMBI GATC 2 cut(s) 121, 181
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstUI CGCG 1 cut(s) 47
BstXI CCANNNNNNTGG 1 cut(s) 92
BsuRI GGCC 2 cut(s) 5, 128
BtsIMutI CAGTG 1 cut(s) 109
Cac8I GCNNGC 1 cut(s) 47
CfoI GCGC 2 cut(s) 47, 49
Csp6I GTAC 1 cut(s) 18
CviAII CATG 2 cut(s) 68, 86
CviJI RGCY 3 cut(s) 5, 14, 128
CviKI_1 RGCY 3 cut(s) 5, 14, 128
CviQI GTAC 1 cut(s) 18
DpnI GATC 2 cut(s) 123, 183
DpnII GATC 2 cut(s) 121, 181
EaeI YGGCCR 1 cut(s) 3
Eco32I GATATC 1 cut(s) 212
Eco88I CYCGRG 1 cut(s) 50
EcoRV GATATC 1 cut(s) 212
FaeI CATG 2 cut(s) 71, 89
FaiI YATR 4 cut(s) 60, 69, 87, 201
FatI CATG 2 cut(s) 67, 85
FbaI TGATCA 2 cut(s) 121, 181
GlaI GCGC 2 cut(s) 46, 48
HaeIII GGCC 2 cut(s) 5, 128
HhaI GCGC 2 cut(s) 47, 49
Hin1II CATG 2 cut(s) 71, 89
Hin6I GCGC 2 cut(s) 45, 47
HinP1I GCGC 2 cut(s) 45, 47
HphI GGTGA 2 cut(s) 83, 107
Hpy188III TCNNGA 2 cut(s) 185, 215
HpyAV CCTTC 3 cut(s) 68, 167, 200
HpyCH4IV ACGT 1 cut(s) 233
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 233
Hsp92II CATG 2 cut(s) 71, 89
HspAI GCGC 2 cut(s) 45, 47
Ksp22I TGATCA 2 cut(s) 121, 181
Kzo9I GATC 2 cut(s) 121, 181
LmnI GCTCC 1 cut(s) 42
LpnPI CCDG 3 cut(s) 110, 170, 228
LweI GCATC 1 cut(s) 213
MaeII ACGT 1 cut(s) 233
MaeIII GTNAC 1 cut(s) 77
MalI GATC 2 cut(s) 123, 183
MboI GATC 2 cut(s) 121, 181
MboII GAAGA 2 cut(s) 119, 155
MnlI CCTC 1 cut(s) 222
MseI TTAA 2 cut(s) 162, 241
MslI CAYNNNNRTG 1 cut(s) 90
MvnI CGCG 1 cut(s) 47
MwoI GCNNNNNNNGC 1 cut(s) 11
NdeII GATC 2 cut(s) 121, 181
NlaIII CATG 2 cut(s) 71, 89
PauI GCGCGC 1 cut(s) 45
PteI GCGCGC 1 cut(s) 45
RsaI GTAC 1 cut(s) 19
RsaNI GTAC 1 cut(s) 18
RseI CAYNNNNRTG 1 cut(s) 90
SaqAI TTAA 2 cut(s) 162, 241
Sau3AI GATC 2 cut(s) 121, 181
SetI ASST 4 cut(s) 16, 79, 178, 236
SfaNI GCATC 1 cut(s) 213
SmiMI CAYNNNNRTG 1 cut(s) 90
SsiI CCGC 1 cut(s) 226
TaiI ACGT 1 cut(s) 236
Tru1I TTAA 2 cut(s) 162, 241
Tru9I TTAA 2 cut(s) 162, 241
TscAI CASTG 1 cut(s) 109
TspDTI ATGAA 2 cut(s) 168, 219
TspRI CASTG 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.