Rh6DG206500

Small acidic protein family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0003825
Physical Location & Seq
Forward (+)
36772789 .. 36773665
877 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG206500.1

Sequence Viewer

Length: 177 bp
ATGGACTCAAACTTGGACTCTCCATTCACAGACAGGGGGACTGCATTTTCCAAGCCTTCAAAAGATAAAGTTAAAAGGAATTATCGGCGTCGTTCTCCTGGAGTCCTGACTCCTGAGCATAATAACAGCTCTAGCCCAAAACTTGCAATGGGAGATCCTGGAAAAGAATGGAGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
SMAP

Protein Analysis

58

Amino Acids

6.55

Weight (kDa)

10.11

Isoelectric Point (pI)

75.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 149
AcyI GRCGYC 1 cut(s) 88
AgsI TTSAA 1 cut(s) 60
AjnI CCWGG 2 cut(s) 97, 157
AluBI AGCT 1 cut(s) 129
AluI AGCT 1 cut(s) 129
AlwI GGATC 1 cut(s) 149
BciT130I CCWGG 2 cut(s) 99, 159
BfaI CTAG 1 cut(s) 132
Bme1390I CCNGG 2 cut(s) 99, 159
BmrFI CCNGG 2 cut(s) 99, 159
BpmI CTGGAG 1 cut(s) 120
Bpu10I CCTNAGC 1 cut(s) 114
BsaHI GRCGYC 1 cut(s) 88
Bse3DI GCAATG 1 cut(s) 153
BseBI CCWGG 2 cut(s) 99, 159
BseMI GCAATG 1 cut(s) 153
BseMII CTCAG 1 cut(s) 105
BslFI GGGAC 1 cut(s) 52
BsmFI GGGAC 1 cut(s) 52
Bsp143I GATC 1 cut(s) 154
BspCNI CTCAG 1 cut(s) 106
BspPI GGATC 1 cut(s) 149
BsrDI GCAATG 1 cut(s) 153
BssMI GATC 1 cut(s) 154
BssNI GRCGYC 1 cut(s) 88
Bst2UI CCWGG 2 cut(s) 99, 159
BstACI GRCGYC 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 114
BstKTI GATC 1 cut(s) 157
BstMBI GATC 1 cut(s) 154
BstNI CCWGG 2 cut(s) 99, 159
BstSCI CCNGG 2 cut(s) 97, 157
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
CseI GACGC 1 cut(s) 77
CviJI RGCY 3 cut(s) 55, 129, 135
CviKI_1 RGCY 3 cut(s) 55, 129, 135
DdeI CTNAG 1 cut(s) 114
DpnI GATC 1 cut(s) 156
DpnII GATC 1 cut(s) 154
EcoRII CCWGG 2 cut(s) 97, 157
FaiI YATR 1 cut(s) 120
FaqI GGGAC 1 cut(s) 52
FspBI CTAG 1 cut(s) 132
GsuI CTGGAG 1 cut(s) 120
HgaI GACGC 1 cut(s) 77
Hin1I GRCGYC 1 cut(s) 88
HinfI GANTC 4 cut(s) 5, 17, 102, 109
Hpy188III TCNNGA 2 cut(s) 106, 113
Hpy99I CGWCG 1 cut(s) 93
HpyAV CCTTC 1 cut(s) 66
HpyCH4V TGCA 2 cut(s) 44, 146
HpyF3I CTNAG 1 cut(s) 114
Hsp92I GRCGYC 1 cut(s) 88
Kzo9I GATC 1 cut(s) 154
LpnPI CCDG 7 cut(s) 19, 84, 111, 119, 126, 144, 171
MaeI CTAG 1 cut(s) 132
MalI GATC 1 cut(s) 156
MboI GATC 1 cut(s) 154
MflI RGATCY 1 cut(s) 154
MluCI AATT 1 cut(s) 79
MlyI GAGTC 3 cut(s) 11, 103, 111
MnlI CCTC 1 cut(s) 165
MseI TTAA 1 cut(s) 72
MspR9I CCNGG 2 cut(s) 99, 159
MvaI CCWGG 2 cut(s) 99, 159
NdeII GATC 1 cut(s) 154
PfoI TCCNGGA 2 cut(s) 97, 157
PleI GAGTC 3 cut(s) 11, 103, 110
PpsI GAGTC 3 cut(s) 11, 103, 110
Psp6I CCWGG 2 cut(s) 97, 157
PspGI CCWGG 2 cut(s) 97, 157
PsuI RGATCY 1 cut(s) 154
SaqAI TTAA 1 cut(s) 72
Sau3AI GATC 1 cut(s) 154
SchI GAGTC 3 cut(s) 11, 103, 111
ScrFI CCNGG 2 cut(s) 99, 159
SetI ASST 2 cut(s) 131, 176
Sse9I AATT 1 cut(s) 79
SspMI CTAG 1 cut(s) 132
StyD4I CCNGG 2 cut(s) 97, 157
TasI AATT 1 cut(s) 79
Tru1I TTAA 1 cut(s) 72
Tru9I TTAA 1 cut(s) 72
XspI CTAG 1 cut(s) 132
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.