Rh7BG294400

ACT domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
27659501 .. 27660154
654 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG294400.1

Sequence Viewer

Length: 213 bp
ATGGCTCCTCCTCCAGGGATTGTTGTCACCCTTTTGCTTCTTCTTGCTCTGCAGAGTTATGGGTTCGTTCTTTCTTTTGCTTCCACAAATACTACATGTTCCTCGCCCCCTGCAGTTTATCTATTGAAGTTTCTTTGCTCTGACCGTAATGGATTATTGCATGATGTCACTGAAATTCTGTCTGATCTTGAGCTTTCGATTCAAAGGGTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.56

Weight (kDa)

4.83

Isoelectric Point (pI)

40.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 174
AfiI CCNNNNNNNGG 1 cut(s) 14
AflIII ACRYGT 1 cut(s) 95
AgsI TTSAA 2 cut(s) 127, 203
AjnI CCWGG 1 cut(s) 13
AluBI AGCT 1 cut(s) 193
AluI AGCT 1 cut(s) 193
ApoI RAATTY 1 cut(s) 174
AsuHPI GGTGA 1 cut(s) 19
BciT130I CCWGG 1 cut(s) 15
BfmI CTRYAG 2 cut(s) 50, 111
Bme1390I CCNGG 1 cut(s) 15
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 15
BpuEI CTTGAG 1 cut(s) 209
BsaJI CCNNGG 1 cut(s) 14
Bsc4I CCNNNNNNNGG 1 cut(s) 14
BseBI CCWGG 1 cut(s) 15
BseDI CCNNGG 1 cut(s) 14
BseLI CCNNNNNNNGG 1 cut(s) 14
BslI CCNNNNNNNGG 1 cut(s) 14
Bsp143I GATC 1 cut(s) 184
BspLI GGNNCC 1 cut(s) 6
BspMAI CTGCAG 2 cut(s) 54, 115
BssECI CCNNGG 1 cut(s) 14
BssMI GATC 1 cut(s) 184
Bst2UI CCWGG 1 cut(s) 15
Bst4CI ACNGT 1 cut(s) 146
BstENI CCTNNNNNAGG 1 cut(s) 12
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BstNI CCWGG 1 cut(s) 15
BstNSI RCATGY 1 cut(s) 99
BstSCI CCNGG 1 cut(s) 13
BstSFI CTRYAG 2 cut(s) 50, 111
BtsIMutI CAGTG 1 cut(s) 168
CviAII CATG 2 cut(s) 96, 161
CviJI RGCY 2 cut(s) 5, 193
CviKI_1 RGCY 2 cut(s) 5, 193
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
EcoNI CCTNNNNNAGG 1 cut(s) 12
EcoRII CCWGG 1 cut(s) 13
FaeI CATG 2 cut(s) 99, 164
FaiI YATR 3 cut(s) 60, 97, 162
FatI CATG 2 cut(s) 95, 160
Hin1II CATG 2 cut(s) 99, 164
HinfI GANTC 1 cut(s) 199
HphI GGTGA 1 cut(s) 19
Hpy188I TCNGA 2 cut(s) 142, 184
Hpy188III TCNNGA 1 cut(s) 188
HpyCH4III ACNGT 1 cut(s) 146
HpyCH4V TGCA 3 cut(s) 52, 113, 160
Hsp92II CATG 2 cut(s) 99, 164
Kzo9I GATC 1 cut(s) 184
LmnI GCTCC 1 cut(s) 10
LpnPI CCDG 2 cut(s) 27, 123
MaeIII GTNAC 2 cut(s) 25, 166
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MboII GAAGA 1 cut(s) 32
MluCI AATT 1 cut(s) 174
MnlI CCTC 3 cut(s) 18, 21, 112
MspR9I CCNGG 1 cut(s) 15
MvaI CCWGG 1 cut(s) 15
NdeII GATC 1 cut(s) 184
NlaIII CATG 2 cut(s) 99, 164
NlaIV GGNNCC 1 cut(s) 6
NmuCI GTSAC 2 cut(s) 25, 166
NspI RCATGY 1 cut(s) 99
PciI ACATGT 1 cut(s) 95
PfeI GAWTC 1 cut(s) 199
PscI ACATGT 1 cut(s) 95
Psp6I CCWGG 1 cut(s) 13
PspGI CCWGG 1 cut(s) 13
PspN4I GGNNCC 1 cut(s) 6
PstI CTGCAG 2 cut(s) 54, 115
Sau3AI GATC 1 cut(s) 184
ScrFI CCNGG 1 cut(s) 15
SetI ASST 1 cut(s) 195
SfcI CTRYAG 2 cut(s) 50, 111
SgeI CNNG 8 cut(s) 26, 27, 56, 108, 115, 122, 173, 200
SmlI CTYRAG 1 cut(s) 188
SmoI CTYRAG 1 cut(s) 188
Sse9I AATT 1 cut(s) 174
StyD4I CCNGG 1 cut(s) 13
TaaI ACNGT 1 cut(s) 146
TaqI TCGA 1 cut(s) 197
TasI AATT 1 cut(s) 174
TfiI GAWTC 1 cut(s) 199
TscAI CASTG 1 cut(s) 175
TseFI GTSAC 2 cut(s) 25, 166
Tsp45I GTSAC 2 cut(s) 25, 166
TspRI CASTG 1 cut(s) 175
XagI CCTNNNNNAGG 1 cut(s) 12
XapI RAATTY 1 cut(s) 174
XceI RCATGY 1 cut(s) 99
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.