Rh7DG161800

Domain in histone families 1 and 5

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Forward (+)
14395530 .. 14395841
312 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG161800.1

Sequence Viewer

Length: 204 bp
ATGCAAAGCAAACTTAGCTGCCGAGAAGGGGGCGTGGAACCTGACAACAACAACAACACCGCCGCCACTGCTCATGTAGCTGCCAACCCCACTCATGCTCCTGCCCCTACTTTCAACCACCCTCCTTATGCTGAGATGATACACACAGCTATTGCAGCGTTGATGGAGAGAGACAGGTCGAGTAGGAGAGCTATAGCTAAGTAG

Protein Analysis

67

Amino Acids

7.21

Weight (kDa)

8.02

Isoelectric Point (pI)

56.4

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Linker_histone PF00538 40 - 67 4.3e-07 linker histone H1 and H5 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009974)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 60, 63
AfiI CCNNNNNNNGG 1 cut(s) 28
AgsI TTSAA 1 cut(s) 115
AluBI AGCT 5 cut(s) 18, 80, 149, 191, 197
AluI AGCT 5 cut(s) 18, 80, 149, 191, 197
Alw26I GTCTC 1 cut(s) 165
ApeKI GCWGC 3 cut(s) 18, 80, 155
BbvI GCAGC 3 cut(s) 5, 67, 167
BccI CCATC 1 cut(s) 157
BcoDI GTCTC 1 cut(s) 165
BfmI CTRYAG 1 cut(s) 192
BisI GCNGC 4 cut(s) 19, 63, 81, 156
BlsI GCNGC 4 cut(s) 20, 64, 82, 157
BmiI GGNNCC 1 cut(s) 39
BsaXI ACNNNNNCTCC 2 cut(s) 82, 112
Bsc4I CCNNNNNNNGG 1 cut(s) 28
BseLI CCNNNNNNNGG 1 cut(s) 28
BseMII CTCAG 1 cut(s) 123
BseXI GCAGC 3 cut(s) 5, 67, 167
BslI CCNNNNNNNGG 1 cut(s) 28
BsmAI GTCTC 1 cut(s) 165
BspACI CCGC 2 cut(s) 60, 63
BspCNI CTCAG 1 cut(s) 124
BspLI GGNNCC 1 cut(s) 39
BstDEI CTNAG 3 cut(s) 14, 132, 198
BstMAI GTCTC 1 cut(s) 165
BstMWI GCNNNNNNNGC 4 cut(s) 15, 68, 77, 155
BstSFI CTRYAG 1 cut(s) 192
BstV1I GCAGC 3 cut(s) 5, 67, 167
BtsI GCAGTG 1 cut(s) 66
BtsIMutI CAGTG 1 cut(s) 66
CviAII CATG 2 cut(s) 74, 95
CviJI RGCY 5 cut(s) 18, 80, 149, 191, 197
CviKI_1 RGCY 5 cut(s) 18, 80, 149, 191, 197
DdeI CTNAG 3 cut(s) 14, 132, 198
FaeI CATG 2 cut(s) 77, 98
FaiI YATR 4 cut(s) 75, 96, 129, 194
FatI CATG 2 cut(s) 73, 94
Fnu4HI GCNGC 4 cut(s) 19, 63, 81, 156
Fsp4HI GCNGC 4 cut(s) 19, 63, 81, 156
GluI GCNGC 4 cut(s) 19, 63, 81, 156
Hin1II CATG 2 cut(s) 77, 98
HpyAV CCTTC 1 cut(s) 20
HpyCH4V TGCA 2 cut(s) 4, 155
HpyF10VI GCNNNNNNNGC 4 cut(s) 15, 68, 77, 155
HpyF3I CTNAG 3 cut(s) 14, 132, 198
Hsp92II CATG 2 cut(s) 77, 98
LmnI GCTCC 1 cut(s) 103
LpnPI CCDG 3 cut(s) 54, 114, 160
Lsp1109I GCAGC 3 cut(s) 5, 67, 167
MnlI CCTC 1 cut(s) 132
MwoI GCNNNNNNNGC 4 cut(s) 15, 68, 77, 155
NlaIII CATG 2 cut(s) 77, 98
NlaIV GGNNCC 1 cut(s) 39
NmeAIII GCCGAG 1 cut(s) 47
PkrI GCNGC 4 cut(s) 20, 64, 82, 157
PspN4I GGNNCC 1 cut(s) 39
SatI GCNGC 4 cut(s) 19, 63, 81, 156
SetI ASST 7 cut(s) 20, 43, 82, 151, 179, 193, 199
SfcI CTRYAG 1 cut(s) 192
SgeI CNNG 8 cut(s) 35, 46, 53, 86, 107, 113, 187, 192
SsiI CCGC 2 cut(s) 60, 63
TaqI TCGA 1 cut(s) 179
TauI GCSGC 1 cut(s) 65
TscAI CASTG 1 cut(s) 73
TseI GCWGC 3 cut(s) 18, 80, 155
TspRI CASTG 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.