Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr4

Orthogroup ID

OG0010615

Physical Location & Seq

Genomic Coordinates Forward (+)

63130219 .. 63131065

Gene Structure 847 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw4G036280.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 390 bp

ATGCATTCGGGTTCTCTCTTCCCAGCCTCCTCTGCCGTCAAAGCTCATTGCATTTGCTTCTCTCTTCCCATCGATCGATCTCTCCTGTGTCTTCAAAACCCGATTCCGTCGCTTCTCTCTTCCCATCGATCGATCTCTCCTCTGCCGTCAAAGCTCAAAATTAAAGCTTCTCTCTGCCGTCAAAGCTCAAAACTGAAGCTTCTCTCTTCCCATCGATCGATCTCTCCTGTGTCTTCAAAACCCGATTCCTTCGCTCCTCCCCCACACGCCCCAAACCCAAAGCATTCCCGGACCCCAGCTTCTTCAACCTCCTTTCGTACCTGGGGAAGTGAATATGTAGAAATTAATGTAGCCATAGATAGCCTTCATTCAACAATGATAAACATGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

129

Amino Acids

13.97

Weight (kDa)

9.97

Isoelectric Point (pI)

64.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010615)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0344681 RchiOBHm_Chr2g0107051 RchiOBHm_Chr3g0478711
rosa_multiflora	Rmu_co8405135.1_g000001 Rmu_sc0002160.1_g000011 Rmu_sc0002160.1_g000014
rosa_roxburghii	Rroxscaffold_2G00125350 Rroxscaffold_2G00125360 Rroxscaffold_3G00234130 Rroxscaffold_5G00357000
rosa_samantha	Rh1AG152400 Rh1CG143400 Rh3AG045500 Rh3BG047900 Rh5CG054700 Rh5CG152100 Rh5CG498500 Rh6DG266900
rosa_wichuraiana	Rw4G036280 Rw5G006630 Rw6G004890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	215
AfaI	GTAC	1 cut(s)	319
AflIII	ACRYGT	1 cut(s)	384
AgsI	TTSAA	4 cut(s)	95, 237, 306, 372
AjnI	CCWGG	1 cut(s)	320
AluBI	AGCT	6 cut(s)	44, 154, 167, 186, 199, 299
AluI	AGCT	6 cut(s)	44, 154, 167, 186, 199, 299
AseI	ATTAAT	1 cut(s)	345
AspS9I	GGNCC	1 cut(s)	291
AsuC2I	CCSGG	1 cut(s)	289
AvaII	GGWCC	1 cut(s)	291
BbsI	GAAGAC	2 cut(s)	83, 225
BccI	CCATC	3 cut(s)	77, 132, 219
BceAI	ACGGC	3 cut(s)	20, 130, 162
BciT130I	CCWGG	1 cut(s)	322
BcnI	CCSGG	1 cut(s)	289
Bme1390I	CCNGG	2 cut(s)	289, 322
Bme18I	GGWCC	1 cut(s)	291
BmgT120I	GGNCC	1 cut(s)	291
BmiI	GGNNCC	1 cut(s)	293
BmrFI	CCNGG	2 cut(s)	289, 322
BpiI	GAAGAC	2 cut(s)	83, 225
BpuMI	CCSGG	1 cut(s)	289
Bsa29I	ATCGAT	6 cut(s)	72, 76, 127, 131, 214, 218
BsaJI	CCNNGG	1 cut(s)	321
Bse3DI	GCAATG	1 cut(s)	46
BseBI	CCWGG	1 cut(s)	322
BseCI	ATCGAT	6 cut(s)	72, 76, 127, 131, 214, 218
BseDI	CCNNGG	1 cut(s)	321
BseMI	GCAATG	1 cut(s)	46
BseRI	GAGGAG	3 cut(s)	19, 129, 246
BseYI	CCCAGC	2 cut(s)	22, 295
Bsh1285I	CGRYCG	3 cut(s)	76, 131, 218
BshVI	ATCGAT	6 cut(s)	72, 76, 127, 131, 214, 218
BsiEI	CGRYCG	3 cut(s)	76, 131, 218
BsiSI	CCGG	1 cut(s)	289
BsmI	GAATGC	2 cut(s)	4, 283
Bsp143I	GATC	6 cut(s)	73, 77, 128, 132, 215, 219
BspDI	ATCGAT	6 cut(s)	72, 76, 127, 131, 214, 218
BspLI	GGNNCC	1 cut(s)	293
BsrDI	GCAATG	1 cut(s)	46
BssECI	CCNNGG	1 cut(s)	321
BssMI	GATC	6 cut(s)	73, 77, 128, 132, 215, 219
Bst2UI	CCWGG	1 cut(s)	322
Bst6I	CTCTTC	4 cut(s)	23, 69, 124, 211
BstKTI	GATC	6 cut(s)	76, 80, 131, 135, 218, 222
BstMBI	GATC	6 cut(s)	73, 77, 128, 132, 215, 219
BstMCI	CGRYCG	3 cut(s)	76, 131, 218
BstMWI	GCNNNNNNNGC	4 cut(s)	32, 41, 151, 183
BstNI	CCWGG	1 cut(s)	322
BstNSI	RCATGY	1 cut(s)	388
BstSCI	CCNGG	2 cut(s)	287, 320
BstV2I	GAAGAC	2 cut(s)	83, 225
Bsu15I	ATCGAT	6 cut(s)	72, 76, 127, 131, 214, 218
BsuTUI	ATCGAT	6 cut(s)	72, 76, 127, 131, 214, 218
Cfr13I	GGNCC	1 cut(s)	291
ClaI	ATCGAT	6 cut(s)	72, 76, 127, 131, 214, 218
Csp6I	GTAC	1 cut(s)	318
CviAII	CATG	1 cut(s)	385
CviJI	RGCY	9 cut(s)	26, 44, 154, 167, 186, 199, 299, 353, 363
CviKI_1	RGCY	9 cut(s)	26, 44, 154, 167, 186, 199, 299, 353, 363
CviQI	GTAC	1 cut(s)	318
DpnI	GATC	6 cut(s)	75, 79, 130, 134, 217, 221
DpnII	GATC	6 cut(s)	73, 77, 128, 132, 215, 219
Eam1104I	CTCTTC	4 cut(s)	23, 69, 124, 211
EarI	CTCTTC	4 cut(s)	23, 69, 124, 211
Eco47I	GGWCC	1 cut(s)	291
Eco57I	CTGAAG	1 cut(s)	215
EcoRII	CCWGG	1 cut(s)	320
EcoT22I	ATGCAT	1 cut(s)	6
FaeI	CATG	1 cut(s)	388
FaiI	YATR	3 cut(s)	336, 356, 386
FatI	CATG	1 cut(s)	384
GsaI	CCCAGC	2 cut(s)	26, 299
HapII	CCGG	1 cut(s)	289
Hin1II	CATG	1 cut(s)	388
HindIII	AAGCTT	2 cut(s)	165, 197
HinfI	GANTC	2 cut(s)	103, 245
HpaII	CCGG	1 cut(s)	289
Hpy99I	CGWCG	1 cut(s)	112
HpyAV	CCTTC	2 cut(s)	259, 374
HpyCH4V	TGCA	2 cut(s)	4, 51
HpyF10VI	GCNNNNNNNGC	4 cut(s)	32, 41, 151, 183
Hsp92II	CATG	1 cut(s)	388
Kzo9I	GATC	6 cut(s)	73, 77, 128, 132, 215, 219
LmnI	GCTCC	1 cut(s)	259
LpnPI	CCDG	7 cut(s)	36, 98, 240, 302, 307, 309, 334
MalI	GATC	6 cut(s)	75, 79, 130, 134, 217, 221
MboI	GATC	6 cut(s)	73, 77, 128, 132, 215, 219
MboII	GAAGA	7 cut(s)	10, 56, 83, 111, 198, 225, 294
MluCI	AATT	2 cut(s)	159, 342
MnlI	CCTC	5 cut(s)	37, 40, 150, 267, 319
Mph1103I	ATGCAT	1 cut(s)	6
MseI	TTAA	2 cut(s)	162, 345
MspI	CCGG	1 cut(s)	289
MspR9I	CCNGG	2 cut(s)	289, 322
Mva1269I	GAATGC	2 cut(s)	4, 283
MvaI	CCWGG	1 cut(s)	322
MwoI	GCNNNNNNNGC	4 cut(s)	32, 41, 151, 183
NciI	CCSGG	1 cut(s)	289
NdeII	GATC	6 cut(s)	73, 77, 128, 132, 215, 219
NlaIII	CATG	1 cut(s)	388
NlaIV	GGNNCC	1 cut(s)	293
NsiI	ATGCAT	1 cut(s)	6
NspI	RCATGY	1 cut(s)	388
PciI	ACATGT	1 cut(s)	384
PctI	GAATGC	2 cut(s)	4, 283
PfeI	GAWTC	2 cut(s)	103, 245
PfoI	TCCNGGA	1 cut(s)	287
Ple19I	CGATCG	3 cut(s)	76, 131, 218
PscI	ACATGT	1 cut(s)	384
PshBI	ATTAAT	1 cut(s)	345
Psp6I	CCWGG	1 cut(s)	320
PspFI	CCCAGC	2 cut(s)	22, 295
PspGI	CCWGG	1 cut(s)	320
PspN4I	GGNNCC	1 cut(s)	293
PspPI	GGNCC	1 cut(s)	291
PvuI	CGATCG	3 cut(s)	76, 131, 218
RsaI	GTAC	1 cut(s)	319
RsaNI	GTAC	1 cut(s)	318
SaqAI	TTAA	2 cut(s)	162, 345
Sau3AI	GATC	6 cut(s)	73, 77, 128, 132, 215, 219
Sau96I	GGNCC	1 cut(s)	291
ScrFI	CCNGG	2 cut(s)	289, 322
SetI	ASST	8 cut(s)	46, 156, 169, 188, 201, 301, 311, 323
SinI	GGWCC	1 cut(s)	291
Sse9I	AATT	2 cut(s)	159, 342
StyD4I	CCNGG	2 cut(s)	287, 320
TaqI	TCGA	6 cut(s)	72, 76, 127, 131, 214, 218
TasI	AATT	2 cut(s)	159, 342
TfiI	GAWTC	2 cut(s)	103, 245
Tru1I	TTAA	2 cut(s)	162, 345
Tru9I	TTAA	2 cut(s)	162, 345
TspDTI	ATGAA	1 cut(s)	356
TspGWI	ACGGA	1 cut(s)	96
VpaK11BI	GGWCC	1 cut(s)	291
VspI	ATTAAT	1 cut(s)	345
XceI	RCATGY	1 cut(s)	388
Zsp2I	ATGCAT	1 cut(s)	6

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.