Basic Information

Type: gene

Biological Identity

Species

rosa_wichuraiana

Chromosome

Chr5

Orthogroup ID

OG0010615

Physical Location & Seq

Genomic Coordinates Forward (+)

6835463 .. 6835883

Gene Structure 421 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rw5G006630.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 300 bp

ATGGAAACACGGAGTGAACAGGATTCATTTAATGAAATTTTACTCTTTTTTCCAATTATGTCCTCATCTTTTAACCTCGACCCAGATAGGGTTTTGTTATTCTCAGCTTCTCTCTTCCAGTCTTCCCAGCCTCCTCTATCGTCAAAACTCAAAACACCTTCTTCCCATCGATCGATCTCTCCTGTGTCTTCAAAACTCGATTCCGTCGTTCCTCCGCCACACGCCCCAAACCCAAAGCATTCCCGGTCCTTCTTCAACCTCCTTTCGTACTTGGTATCTTATCTTGACGTGATGGAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

99

Amino Acids

11.13

Weight (kDa)

6.26

Isoelectric Point (pI)

78.83

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010615)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0344681 RchiOBHm_Chr2g0107051 RchiOBHm_Chr3g0478711
rosa_multiflora	Rmu_co8405135.1_g000001 Rmu_sc0002160.1_g000011 Rmu_sc0002160.1_g000014
rosa_roxburghii	Rroxscaffold_2G00125350 Rroxscaffold_2G00125360 Rroxscaffold_3G00234130 Rroxscaffold_5G00357000
rosa_samantha	Rh1AG152400 Rh1CG143400 Rh3AG045500 Rh3BG047900 Rh5CG054700 Rh5CG152100 Rh5CG498500 Rh6DG266900
rosa_wichuraiana	Rw4G036280 Rw5G006630 Rw6G004890

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	215
AcsI	RAATTY	1 cut(s)	36
AdeI	CACNNNGTG	1 cut(s)	14
AfaI	GTAC	1 cut(s)	269
AfiI	CCNNNNNNNGG	1 cut(s)	88
AgsI	TTSAA	2 cut(s)	192, 256
AjiI	CACGTC	1 cut(s)	289
AluBI	AGCT	1 cut(s)	107
AluI	AGCT	1 cut(s)	107
ApoI	RAATTY	1 cut(s)	36
AspS9I	GGNCC	1 cut(s)	246
AsuC2I	CCSGG	1 cut(s)	244
AvaII	GGWCC	1 cut(s)	246
BbsI	GAAGAC	2 cut(s)	114, 180
BccI	CCATC	2 cut(s)	174, 286
BcnI	CCSGG	1 cut(s)	244
Bme1390I	CCNGG	1 cut(s)	244
Bme18I	GGWCC	1 cut(s)	246
BmgBI	CACGTC	1 cut(s)	289
BmgT120I	GGNCC	1 cut(s)	246
BmrFI	CCNGG	1 cut(s)	244
BpiI	GAAGAC	2 cut(s)	114, 180
BpuMI	CCSGG	1 cut(s)	244
Bsa29I	ATCGAT	2 cut(s)	169, 173
Bsc4I	CCNNNNNNNGG	1 cut(s)	88
Bse1I	ACTGG	1 cut(s)	118
BseCI	ATCGAT	2 cut(s)	169, 173
BseLI	CCNNNNNNNGG	1 cut(s)	88
BseMII	CTCAG	1 cut(s)	117
BseNI	ACTGG	1 cut(s)	118
BseRI	GAGGAG	1 cut(s)	123
BseYI	CCCAGC	1 cut(s)	126
Bsh1285I	CGRYCG	1 cut(s)	173
BshVI	ATCGAT	2 cut(s)	169, 173
BsiEI	CGRYCG	1 cut(s)	173
BsiSI	CCGG	1 cut(s)	244
BslI	CCNNNNNNNGG	1 cut(s)	88
BsmI	GAATGC	1 cut(s)	238
Bsp143I	GATC	2 cut(s)	170, 174
BspACI	CCGC	1 cut(s)	215
BspCNI	CTCAG	1 cut(s)	116
BspDI	ATCGAT	2 cut(s)	169, 173
BsrI	ACTGG	1 cut(s)	118
BssMI	GATC	2 cut(s)	170, 174
Bst6I	CTCTTC	1 cut(s)	119
BstDEI	CTNAG	1 cut(s)	103
BstKTI	GATC	2 cut(s)	173, 177
BstMBI	GATC	2 cut(s)	170, 174
BstMCI	CGRYCG	1 cut(s)	173
BstSCI	CCNGG	1 cut(s)	242
BstV2I	GAAGAC	2 cut(s)	114, 180
Bsu15I	ATCGAT	2 cut(s)	169, 173
BsuTUI	ATCGAT	2 cut(s)	169, 173
BtrI	CACGTC	1 cut(s)	289
Cfr13I	GGNCC	1 cut(s)	246
ClaI	ATCGAT	2 cut(s)	169, 173
Csp6I	GTAC	1 cut(s)	268
CviJI	RGCY	2 cut(s)	107, 130
CviKI_1	RGCY	2 cut(s)	107, 130
CviQI	GTAC	1 cut(s)	268
DdeI	CTNAG	1 cut(s)	103
DpnI	GATC	2 cut(s)	172, 176
DpnII	GATC	2 cut(s)	170, 174
DraIII	CACNNNGTG	1 cut(s)	14
Eam1104I	CTCTTC	1 cut(s)	119
EarI	CTCTTC	1 cut(s)	119
EciI	GGCGGA	1 cut(s)	204
Eco47I	GGWCC	1 cut(s)	246
FaiI	YATR	1 cut(s)	59
GsaI	CCCAGC	1 cut(s)	130
HapII	CCGG	1 cut(s)	244
HinfI	GANTC	2 cut(s)	23, 200
HpaII	CCGG	1 cut(s)	244
Hpy166II	GTNNAC	1 cut(s)	17
Hpy188III	TCNNGA	1 cut(s)	284
Hpy8I	GTNNAC	1 cut(s)	17
Hpy99I	CGWCG	1 cut(s)	209
HpyAV	CCTTC	2 cut(s)	168, 259
HpyCH4IV	ACGT	1 cut(s)	288
HpyF3I	CTNAG	1 cut(s)	103
HpySE526I	ACGT	1 cut(s)	288
Kzo9I	GATC	2 cut(s)	170, 174
LpnPI	CCDG	6 cut(s)	5, 96, 131, 140, 195, 257
MaeII	ACGT	1 cut(s)	288
MalI	GATC	2 cut(s)	172, 176
MboI	GATC	2 cut(s)	170, 174
MboII	GAAGA	5 cut(s)	106, 114, 153, 180, 244
MluCI	AATT	2 cut(s)	36, 54
MnlI	CCTC	6 cut(s)	73, 86, 141, 144, 222, 269
MseI	TTAA	2 cut(s)	30, 72
MspI	CCGG	1 cut(s)	244
MspR9I	CCNGG	1 cut(s)	244
Mva1269I	GAATGC	1 cut(s)	238
NciI	CCSGG	1 cut(s)	244
NdeII	GATC	2 cut(s)	170, 174
PcsI	WCGNNNNNNNCGW	1 cut(s)	204
PctI	GAATGC	1 cut(s)	238
PfeI	GAWTC	2 cut(s)	23, 200
Ple19I	CGATCG	1 cut(s)	173
PspFI	CCCAGC	1 cut(s)	126
PspPI	GGNCC	1 cut(s)	246
PvuI	CGATCG	1 cut(s)	173
RsaI	GTAC	1 cut(s)	269
RsaNI	GTAC	1 cut(s)	268
SaqAI	TTAA	2 cut(s)	30, 72
Sau3AI	GATC	2 cut(s)	170, 174
Sau96I	GGNCC	1 cut(s)	246
ScrFI	CCNGG	1 cut(s)	244
SetI	ASST	5 cut(s)	78, 109, 160, 261, 291
SinI	GGWCC	1 cut(s)	246
Sse9I	AATT	2 cut(s)	36, 54
SsiI	CCGC	1 cut(s)	215
StyD4I	CCNGG	1 cut(s)	242
TaiI	ACGT	1 cut(s)	291
TaqI	TCGA	4 cut(s)	78, 169, 173, 198
TasI	AATT	2 cut(s)	36, 54
TfiI	GAWTC	2 cut(s)	23, 200
Tru1I	TTAA	2 cut(s)	30, 72
Tru9I	TTAA	2 cut(s)	30, 72
TspDTI	ATGAA	2 cut(s)	15, 48
TspGWI	ACGGA	2 cut(s)	25, 193
VpaK11BI	GGWCC	1 cut(s)	246
XapI	RAATTY	1 cut(s)	36

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.